Description :
From Genome Similarity Track
Location :
contig_22:28020- 29460
Transcript NameFunction/comments
g5840.t1POM61949.1 hypothetical protein PHPALM_28953 [Phytophthora palmivora var. palmivora
g5841.t1RAW40786.1 hypothetical protein PC110_g3055 [Phytophthora cactorum

Sequence
1440 bases(100 bases per row)
ACCAGCTCATGGCGAGTGCTTCTGTCTGTGGATACTTGCACGTGTCTTGGCCTCGCCGTCGGTGCTTGTGACGTGGCGGCGGCCGATTGCTGCAGTTGAG
AGTCAGTAGCCGGAACGACGGCACTCACTCGGGGTATACATGTGTACCACATGAGTTAGACAGTGTAGCCCTGGGTTTTCGTTAGCTGCATCCATGCTGG
GGACTTGAGCGCGTAGACAACTTGCAGCAATTTCATTTCAAGCATTTTGACTGTTGTTGAAGGTGCCCTACTCTATCGTCTCTGCTTGCGACTTTCGAAC
TTGCGGAATCGGGATACGGCGCGATCGTCGCTGGCCTGATTCTTGCCCACTGCAAACAGCAACAGGATGTTAGATGTCAAACTGATCAAACTGGGATTAC
CGCAGTGAACTAGCACACCTTTGTGGAATCCCCGCTCGCGTTGCTCGTCTACAATGTACACAGCATTCCAACACCCATCAGCCACCAACCCACCTCACCA
AACAACTCCACGCTCATCCTCTTACCTTTGTTCAGACTCTTCATCTCCGCAACATAGTCCGTTCGGTGTCGATTGAAGTCGACACTGAAGTTTGCCGGCA
GCACAGAGCTCGCAAGTCCTCCCACGGCATCCAGCTTTGCAGCGCTGGATTTACTCGCCTCTAACGCTCTCCTTGTTGCCTTCTCCGTCCTCTCTGCATA
TAGCGCCGGCAGCTCCACTTCTGCAATGCCTGCACTCCCCATGAGCATCCCTCCTTCCGTCCCTTCATCGTAACTCTGGTTACCCATCGGTACATCAGGT
TTCAAGTGCTCCGGCAGCTCGAACAGCTTGTCCTCCGCACTCTTCATAGCCGCAGCTGCGTCCTCACTGACTGCGTTCTGCTGCGTCTCCGTCTTCCGCT
TCTTCTGCAGCCTCTCCTCTATGAACTGGTTCATGAGCTCCTCGTGTTGGTCCTTGTCGGTCGTGGCGCTTTGGCCCGTGAACTGTCCGTCCAGCAGCGT
CAGCAGCTTCTGATTGGCCGATCCCTCCTTCTTGGGGTCGTGCAGCCCGTACTGAGCGCTCTCCGCTGGTACTTCCATCTTTTTGTGCTGCTTCTTGGCC
GCCTCAGCCTTGTGACTGGCCAGCTCCCCCCGCAGCACCTGCTCCCGCAGTCGCTGGTCCTCGCGCAGCTCCTTGATCGAGCGCTGGATCTGCTCCACGT
CTACATCCTCGCATTGCGCATCTTCAGAGGCGCCGTTTGCATCGTCTAGAGGGCGTCGAGAGCGCTTGCAGCCTGCTCCGCGTTTGCTCTTCTTCTTGAA
GCTCACCTCCATCCGTCACTGGCAAAACGGAGGAAATTGGAAGACGATGATTGGATGAAAAAAACTGGAGGAAAGTTTATGGGTAGTTTTGGTGACGAAT
CGAGGAAAATGACTTGTCCACGCCGGCGCTTCCTGAAAGG