Description :
From Genome Similarity Track
Location :
scaffold_368:28017- 30059
Transcript NameFunction/comments
g7725.t1 hypothetical protein PHYSODRAFT_534487
g7726.t1 hypothetical protein PHYSODRAFT_353225

Sequence
2042 bases(100 bases per row)
TTCTTTTTCCTTTGATGCTTTTTCGGGGCGGCTTCTGGTTATCCTATTATTTCCTTCCGATCCGGGCGTTACGCAGGCTCGTTCCTAGGTTCAGAGCGTG
CAGGAAGCTCACGCAGGTTTCTCCAGCATTCAAACACTCGCCGCCCACCCACGGACGAAGCTCCGCCCTTCGATCGCAGAGGGGACTCAGTTGAGCATGG
AGTCGCCAGGTGCAACGGTAAAGTGGGCAACCACTACGAAACTTGAGTCGAGACTGGACGAAGCCTCCGCGAGGAAGCATCCAGGCTGCACGTGGCCACC
CGAGAAAGCCGCCGGTCATCAACGCTCGCAGATGGTGGCAGCGTGGCAGGGCAATGGCATCCGCCAGTTCCATGAGCCGCAGGTCGGTGGAGTCCCCCGG
TCCGTCTTGCAGCGGTTGTTAGCGACGCCCTCTGAAAGTGGCCCGGGCACGCCACTGCATAGCCCGCGCCGTCGGTGCTCCGCCGCGTCGGCTGCTGTGG
CGGCCATGGTGCACAGTCCGAGAGCGTTCGCCAGCAACGACCGCCTTGTGCTTGAAAAGAGAGACCCCACGGCCCAAACGGTGCCTTGTCAGTGCTTTTC
GCCCGTGTTCCCGACCCCCGAGTTCGGTAGTTACGAAAGTAGTAGCAACTGCAGCAGTCGGTGCAACAGCCCAGTTCCGACGAGCCCCTTCCCGGATCGC
CCCATTCCGTCCGACGACGAGGAAGACGAAAACGAAGACGACGTTGTCATGCTGCGCCAACAGGTAGCGCTACTGATCAAGAGCCTGGAAGACGAGAAGA
AGCGGCGTGCGTCCGAGCAGCAGTTGATGCAGACTGTAAGTTCTGAGAGTTCACCCGCTTTGAAACTGTAGTCAACTGACCTCTTGTGTCCTGGTAGAAA
ATCATCGAGCTTCAAGGCTTGATCCGCGGGAATGAACACGAGGAGGAGATGGAGTCGCACGGAGACAGGAAGACTTTGCACGGGTTTCCCTCGGCTCGGG
AGAACGAACGGCTGGAGAACAACCAAGTTAGACGATGGTCGGCGCCACTCGAGGAGGACGAGGGAGTCGAAGCTTCGTCTTGTGGCTGCTCCCGGAAGAA
ACAGGATTCAAACGGAGAAGCAGCTGCCAAGCTGCAGCTCACGCGGCTCCGTGCACGAATGCACGCCATTGTCATCGACGCCCAACGCGAAACTCAGTAC
GTTCAATGGCTAGACACACAGTAGAGATGTTAGTCAGTTCCTTACCGGTGCTCGTACCTGTAGATCTCTGCGATCCCAACTGGAAGCGACGAAGCGAAGC
CACAACAAACGGGAGAAGGAGCTGACACTTGAGACAACCATCAAAGTTGCAACACTGGAGCAGAAGCACGCCGTGGCCACGACTCGGCTCGCGCAGCAAG
CTGCCAGCAGTGATGCTCAAGTGGAGACACTGGAGGCCGAAAAGCTGGAGCTCCTCGCGGTTGTGCAGGCGCAACAGGAGCAGCTGAAGCAGCTGAAACT
AGCTCTCGGCGGTAAACAGATCGTGGATGCCTCTCGATGAACGCGAGTCGATAGGTGAAGCCCCCCATGGTTGATTTTTCTTATAAGTGGTGAATGTGCA
GCCTCCGTATACTGCGCTGAAGCAGGAAATGCACAAGACTGGGGCCAGGAAGGGGAAATTCTGTATGAACAGACAGCAAAATGACACAATAGAAACAGAG
GGGAGAAGCATCAGTGCACTCCATGTAGGCGATCGACAGTCTACCTGGGGTCTGCTGCTCTGCTGCTCTGCTGCTCTGCTGCTCTGCTCTCTCCTGGCAA
TCCCTAGCACGCTTCACAGCACACACCATAACTGACAGTGGTAAGGACGCCACAAACTATTGAATAACAATATCAACAGCACAGCCTTGCCACCTGGATG
CACGCCCAGAGCCGCTGAAGTGGTGGTCGAGGTTCGTGGTATATTACGAAGTCGCGTTAAACTTCACCCGGATCTCCTCCTCGCCCAACAGGCCGGCAGT
AATCGAGTTAATGTTCCCCGTGAACACGCGTCGTTCCCATGT