Description :
From Genome Similarity Track
Location :
Scaffold_172:2801- 7683
Sequence
4882 bases(100 bases per row)
TGTATAACATGATCCAGGTATTAAACACTATTATGATCCTACATTCAGCTCGAGTAAGATCACGTATGAACTATCAGGATCGCTTCAGCTGGCAGTCGCC
CATATGCTTCCAGCGTTGAAGATTCACAGGTTACATGCCCCAAAGAATTACCATAATCAAATCTTCCCTAATGATTTGGTGTGGTTGTCAATCACGGTGC
ACCTCGCCTAACATTGGTGATGCGTCCAAACTGGAAGTGTCTTGTTCCATTACAGCCCGCTAGGGGTTGAGCGAGAACTAACTCAATATGTGTTTTGGTC
CAGATGAAGCCTTTCAAAAATCTTTCAATCGTTCTGGCTACCCCTGTTTCGATCTACAGAATGAAGACTATGACAAATGGGCTCACGCTTTTTGATTTTT
ATGGGCGAAAGCCAGGTAATTATCCGACGGCGCCTCCTTTTCTTCTTATATACAATTCAGGACAAATTTTACACGCGTCTGCATGCCGCTAAACGTAGAT
AACGTTTAACAGACGGCTGTACTATATAGGTGACTTCTAATTGATTTTACGCGGAGATAATAGCAATATGATATACGTCGGAAGATAAATATACATTCGT
GGATCTTCAGAAGCGAAATTAACGGCTTTTTGAGTCAAGTTTATAGAAGTCTTCACTTCGACAATAATCCTGAGCGATCAACAGATGAACTGATTTCCTT
ATCCCATGCTGTGGTAGTGGTCATGTAATGTTTGCGCAAAACTTATTCATATCCTTCAGTTGGGGGCTACGTCACTGAGTAATGGCCTTAAAAAGCCGTT
GCTATGCGATTGTCGAATGAATGGGATATTAAGTCCGTCCCAATTTTTATGTTGAACCATTGCGCGTTGCGTCTTAATGCAATCACTCCTGATACACGAA
TGGTACCGACCATATCTATTACATCATGAAGAATGTAAAACGATTCATAGCTACCGATAGACATCAGGATTTATTTGAGCATTCTTATACAGCCTGTATC
CGGAGGATCAACGTATTCTCTAATAGTTGATTCGGTGATTCTTTGAGAGAGTGATATGGTGCCCCCAGTTGTTTCCAATGAATATCCTGCTCCAATTGGT
GTTCATTGGAATTGCAACGAAAATCAGATCTTCTTTAATTGGACAGATTAAAGAATCATTTCGGTAATATCTCGCGATGAAAACTTCGACCAATGTCCAT
AATCTCCAATTTGTCATTGTATCCCGCAAGTGCAATCTTCGTTTTGACCGTACTATCTTCTGTTGTCTCCACTGAGGTGAGGCTGTTCACTTTGCTTGGA
CTATCTGTCCAATTATCTGAGCAATCAATGCAGCTAAAATTAACTAGCTTAACCATCGAATATTTCAGCTGATCGTAAGAGACCGAGAGAACATCGAAGT
TTACTTCCGTGTCAATTAAAAACTGACAACTCGTGTGATGAAGCCGTAACATGTAAAACGATTCACTGGATAGACGGATGATAGTTGTAATATATTTCTA
TGAATATCGATTTCTCTTTATCCTCTTTGCATGAACTCTAAGATAGGAACGAATAATAATATCAAAGAAAAATTCATTAACATATGATGGGTCATAAAAC
TAGCCAAAATGCGTATGTGGCCCACCCGTCATGTCAATGGCTATAAGATATTATCACTGGTACCATATTGAGTACAAGTGAGACCAACTAATTTTCAAAG
CAAGGTGTATAGAAGGTGGTGGCTAGATTAAAATATATTGATATGCGTTCGGCTGGACAAACCTGCAGACACTACTGCCCGGAATGCTCGATACATACGC
GAATTCTCTAAATTTTTCGCTGTAAATAAAATTATTCTCAACATAGATCAGCCTACATCCTACATCCCTAAAACTACCTTCATATGAAAGGGTATACCGT
GTCACCTACTTACAACAAGTATTATTATTATTATCCTCTGTCCTTTTCGGCGAAGACGTGCACATCCCTGCCTATTAAGCTCGTTAACCCCTAGAAACGC
TCGACTTTATGCTGGGGTTGGGTCTGTCGACGGTAAAATGGATCGACTTGATCATGGTTTGCTTGCCGATAGGCTTTAGGTTGACACAATCGTCATACCT
GACTCGGTCGATTTTGCTTCTTTCTTACGCTGTTGTAAACAACCCACTTACTAAAAGAGCCAATATATTACTTTAAACGACTTGGTACCTGCCGAACTGG
TTTCCACTGTAAATTTATGTCTGGTTGAAAAATTTGTATGCACCTATCCTATTTTAAGATGAAGTTTGCACGAAATACCTTGTAAAAGGACAGTTAATTC
GTCTTCTTGCTGGGGCCAATCTGGAATCGGGTGTACTTCTAATATCAATTAAAATTGACTCATAGATCTGTATACCCATCGACCAATTTATATTGCTAGT
ACCTAATTGACTGGCATAAGTTCGCAAAACACCAAATCGGTATATCCCTGACCCATATAATAATCCAAGATACTAATCAAATGTCTGACCAAACGATATC
CATACACGATCAGTGCTTAAATTACCAACAGTATTTATTTGATGCATACTTCAGCGGTCCAGACCCATATCAGTATCAATCGATATATCTCTTGCAAATC
CCCGTATCCGTCTGTGATACATGTATCCATTAATTGTTCTTTCCGACGGCTGTATATGGATCTCATTAAATGTACCACGAAATCTAACGTGGAACACCAA
ATGTCCGCATATAGATAGTTCGGATCGGGAATACGTCGATAATGGTTCTTATTTGATCGGCTGCATCGTCAACTTCACCAACTAGACGTGCTTGTATTTG
CAGTTAACCATCATCGATCGCTATTTTAACGGCAAACTACCCGCCGTGAGTAAAACACGTTAATCGGTATCACCATAATCGATGTGGAAGTCCCACTTAT
TGAGGTACTTACCTACTCTGTATCCAGCCTAATTTGAGTCCTGATTTTTATTTACATAGACAGCGACGCAGATATTATCAAAATTACACGGATAAAACCG
TTAGCGAACCATTGATGGATCTTTCAACCGTATCTTTTGTTCGTCAATCTACCACAAAATTGTCGGTTGGTTTAATAACAAGGTCTAGAGCTCCAATACT
ATTCAAAATTGTAACATCAAACTTTTGTCCGATTGAGTCCACTTTGGAGCGATGAGTCATAGTATACACCTCAGATTCACACAGCACCCTCTCTCTATTT
CATTTAAATGCTGCGGCTACGTAAAGCCCATCGAATTGTCATATCCAAAATAAATTCTGTGCGATCGACACGGTCGGTCACAGCAGCTCCAACATTCTTA
TACTGTATCCGCTCCCTTCAGGCGTCAATTTAGTAGACGCATGAAATTCCATACATTCCCTTATACTTAACCTCATGCGTTACGGAGAAAGTGAACAAGA
ATTTAAACAGCGATTATGCTTCTAGATAAGTACGAAACACCAATGACGGGGAGATTGTGGTCCAATAGCCCCACCTGTTCTCAATACCATGGCATCAACG
GGTGCCATAGAAGATGACAAACGTTATTGTGGAATAAAAATACCGTTGAGTTATCGGAATAATGAAAAGAAGACAACCATCATTTTTACAGAATGTCGAC
TGGCTAATTTGGAGTCCATTCCTATTTTCGGTCATGGAGACCGATCGGACCAATATGTAGATATTGGATAGAGAAAGTAATGCTGGCAGGATCTCTATCA
CCAGCCATATCGAGCCTGTCCACAGACCGAGTCTGAGCTATTATAACCCGAGCCCGAGGGAATATTAGTTTGTGTGGATCACAATGATGCGTGTTACCAT
ACGGGAAAAATTACAACTGTGTAAGCCGCTTGCCGGGGACCGCAAAGGAGTTTGCAAGTGTATGTGTCGGTAATGACCACCAACTCGATCACGACCACAA
GTTTGATAGTGATCGCAGCCTCAATCACGATCGCAGTCGGGAAGTGATCGCAGCTCGATCACGACAGGAATTTTGACGAAGTGCACCACTTATCAAAAAG
AACTTTCATTAAAATAAGGGAGATACATGGCAGTCTACCCTGACGTAAGACAGACGTAACGGTAGTTTTTTGGATTTTGATTGCTTAACATTAAATAGAG
TTCAATCTGCTTCTAAAAGCACATTTGTGTTGTTCTTCTTCCGGGTTTTGGAATACTGGGCCACGTGACGTCAGGGCTATACGCACCGTTGTAAATGGGA
TCACTCCTAAATCTGTTTAGACAGGAGTGAAAGGACTCTCACCCCCTAAACTGCGACTGAGCACAGCAAGACAAGCAAAAAAACCACATCTAGAAACGGC
TTAAGTGATTAGAAGGCAAGTGGATCAAGTATCTATGTTCGGTTTTAGGCGATCAAGGCAGATCGCGGTGACTAAAAGAGAGCTATCCAGAGTACGGTGA
GCGATAGGATGAGGACCTTCTACAAGATTAACACCAATCTTTAAGACGGCCGAGTTCAGCATCGGGGTAAGTCCACCAAAAAGAGTGCAACCCGCCATAC
CGACGAGTACAAAATATGAGAGAGAAAAAAATCACGAAATCAGAGTACCTCTCCGATAGTCGGTTGTCTGGACGCCAATGGAGAGTTGGACATGTCTCAT
CAAATGAGCGATCACCACTCCACCTTATTGGGGAGTACCGTGAACTTATCAAATGAGTAGATTGCGGTCAGTAACAGTCTGGGTAGGCCTAGCAGAATTG
ACTTCATATCCTTTGTGTCTTGTTAGACATTTCGACAGATTTTAAATTATTTTTAGACTCTCCCCTAGAGAATCGAATTAGGTTTAACCACTCGCTCTGC
GTTTGTCAGGTGACCTCCGTTGATTTTTTTCGAAATACCTTGTCTATCGTACCACATAAATAAATTTGTAGTCGAAATAAGC