Description :
From Genome Similarity Track
Location :
Scaffold_531:2801- 6522
Sequence
3721 bases(100 bases per row)
TTAAATTTAATACGTTTTTGAAAATCAAATTGATTAATAGCTGACATATTTTTTATTAGGTCATATTTTTTGGAAAAAACATATTTTCAATCTTATTTAT
TCAGATAAGATAAATTTTATTTTATACAAGGTGTGCGAGTATTTGTGCAAATCCACCGCTAAGCCAAGATACGTTCGAAGTCCTTTTGCATCTAAATGCA
CCGCCTAGTCGGTGATCGCCTAGATCTTTTCCGGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTGAGGCTGGTGTACAATTTATGATCACGAATAAGTGTAAGAACCTTCCGTACGTGGAGTTAGCTGACTTTCACATCCGTCTGTTCGA
CTGCATAGACAGACTAGCTGTCATCCATACGGGACGAAGACCGAATATTGTGCGTTAAATGAACGGGACGATCGAATGATACAAAAATCTTGAAAGACTG
TAATCGACGAGGAAATAATAAAAGAAGGATAACCTCTTACGTCGATGTATACCACGACGGCAGAGATCTGCTCGCCAAAATGTTGATCGGTCTTGCACCA
GAACTTGCAACAAATAGGAGATGAATGCTGATTGACGATACTCATATGGGCTATCCGGAAGTCCCAAGTATTAAAGATAAAAAGAAGTTGCAATCACTGG
TTTACAAGAACGGCCATTAACATGTTGAAAAACATACATCTTACCTAATGGGTCACCTGAAGCGTTTTCGACATAGATGTAAGAGAAATCAATAATACCG
CGCAATGGGTCCAGCCTGTAGCACCCAAATTATAAAAAAACAGGCCGATCTAGTCAGTGGAATTTATCGCCAAGATTTTCCGAAAATCTGTCGCACCACG
GGCTTCGCTAATGTAGATATCATCAAAATAACGGCGAGCACATACGGCTGTGTATTGATTACAGGTTGGTGATTCAGCTGACAAGATTAATGGTATACCC
TATGCCTCAGAAGTGAAGTATTGCTGGACATAATAAGAGCTATATGGATTTTTTCCTTGATATGACGAGTGGGTTCAGGGTGGTTGAGACGACGGAACTA
GCAAAATCGATCTTATTATCATCACATAGTCGGTTTTGTAGTGATTAAAGATGACTTTTGGGGTGGTGTAGATTTACCAACATTTGATTGATATCGATAT
GTACGATACGTGAAAAATCTTGCAGGGGACTATTTAGTATCTACTGGATCGTCAAAGTCTGTCGATGCACTAACTGAAGGTTTATTAGCCACCGATCTAA
GATCATCGGTTTTGGGTCAGAGATCGCTTATCGATGACATACTGATAACTTCTGCATTGTGGGATTTCCTATACAAAAAAGTGAAGTAATTGTTCAATTA
GTGAAATGGTTGTAATATTTCGATCATCTGCGCTCAAGGTTTCTAGGGACGTGATAAGGTGTAATAGATAGGGCTTAATGTTTGCTGGCAGGTTTGGAAG
CTAATCCAAAAATCTGATATTGCTGGTGCGTAACCATTTCCTCGGACGCTACGATTGATGTTGTCAGTTCTTCGAAGTATAAATTACGATAGTAGATTCA
TTGAGAACTTTGCAATATATGCGTCCGTGCTGTATAAGATTTTTGAAGCATATTTCCATGACATCAACCCCGCAAGTCATGTCAGACGTCGATCCTTGAT
CCAGACTGGATCGCGATCGCAACTCCCCGAATATATACAAGCCCGATCTCGACTCAAAATAATGGGGATGATTAAGATTCAAAGGGAGGTGATGTTGGCA
AAAGTATGGTATCGCCTCAACGTTTTTTGAAAACAAAGTAGCTAAAATGCTGATTTTGATGCATTTAGATCAGGATCGGCTGCCGGTGATAGTAGTATAT
GCTACTAAGTGGGCACTGTCGGCTGCGTTACTTTTTGAGCACGAAGGTGTATACTAGACGGTCAACTCTCCGATCCTACGCTGACGACTAACCAATTTTT
TTAATATGGTCAAGAATGNNNCAATAGATTTTCTTCAGATATTGTATATTACTTACACTGTGCTGATGTCACACATGATTGCGATGCATACGTGATCATT
ACACTGGCATGGTTGCTACCATCTGAGTGTCTCAACAGAGATTCGGGAAGGTCGGTATACTTATTTTCAAACTGTACTTAGAGATCTGCCAACCTAAAAA
GGGTAAGATGAGAAACTTGGCATGCTGGATTCAAGTATACATCTCGCGAAGTAGTGAATGAAGTCTTAATAAGGATTATCCCACGAAAGTAGCCTATGGT
TTTTGTCTACTCTGACGGTAGGAGGTGGCATGCTTAAGCAGCCAGGGCAGACAATAAGAATGTCACCTCTTACCCTCAGAGTAGACAAAAACTTCTAGTG
GCCCATTTTGATAGGTCGTCTAGAATGAAGCAGAATAGTGGGGCAATAAGCAAAATCGTATAGACTTCGTCGGAATATAAGATCGTAGTGGATGCTTCCG
TGTATACCCCTGATCTGACTATGAAAAAAGCGTAGTACCGAGTATTTCTCCTCTACTTTAACTAGACCGCTGATCAACCAAGGAATTGGTAATTATTTGC
GAATACTTCAAACTGAATGATCTTTCAAATGCGAAAATAGATTGACTGCAAAGCACCAGGGTTGAATTTGCTGCATCATACATATGTAAAGAGACTCATT
GTGGCCAATTAATAGGTTTTTACATATGAAGTGGGACTAGTACAAGTGTATAAATTAGCTAGCAAGCGGGGATCTACAGCGAGATAAGAGACTAATCTCT
GATCATGACCGTCTGGACCTGATCACTCTTAATCAGTTAGGATAACTACTACTACCAGAATGAGTCTATAACTTATTTAATGGGGTCGCAGGTTATCAAT
CTATCCGCATCGAGAAGATGCTGCCAGAACAAGAATTTACAGGAAGCGGTCGTGCAGAAGTATGGATCAATCGTATCATCCAAGAGGAAGACTAATTGCT
ATATAACTTATATTCATTTATATATTTTTGAATGGAGATGTGGCTAGGCTATCGGCGACAGAGACAAACGCTGTACCCTATTCGCACCTAATAATGAGAT
AAATCAAAGTGGATTGCTATATTGATGGAAGAGGTCAGTCACGCAATTGTAATGTCGTGCTTAGGCGGTTAGCTTGATAGGTCCTAAAGTTCCTACAGCG
AAAATGATTGCACCACTACTATACAAGTCTGGACGGTGGTGGCTGAGGAATTAGCCGCATCCATAATAAATTCTCATTGGACAAGTTTAAACAGAAATGT
GCAGCGGTATGTGGTATAATATGTTGATTTTGATACGGTACACGGATAACTCTATGATCGGAGCGTATCTCCTGATAATTTACAAGCGACATAGCTTTTT
AAAGTATTGGACAACAATCACATTTCTTCATTGCCGCGATCTTTTAAATGGAACATAGAGCTTTTATGGTGCATTAATCGTTTTCTAGGTTTATGATCGT
AACATCGATTCGTCCAGAAATGCACAATCTCTTGCAAAGAACTGTGAATTATTTTTATTTATACAGATTGGTGGAAGCGAGGCAAGTCCAATTTCTCTCG
AGCGCTAAATTAGGTCTCGGAAAAACGGCGATCCACCATGGTAGGTAAATGGCAAGCCAATGATAAATAAATAAATATGGTGCGGACACTTACNNNNNNN
NNNGATCAAGAAGCGCGTCAG