Description :
From Genome Similarity Track
Location :
Scaffold_1:2800072- 2802489
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00730hypothetical protein
Phypa_INRA-310PPTG_00731succinate semialdehyde dehydrogenase

Sequence
2417 bases(100 bases per row)
AACGAATACCGATGGGAAAAACCTGAAGACTTTGACGTCAGCTACGAAGCGTTCGCCAGCGGACGCAGTGCCAGTTCTTCGGCTCGTAAATGGTTCGAGA
TGGCTCATGAAAAGGTCAATGACGATGGCAGCAGCTCTCTCACAACTCGATCGTCAAAGTCACGCATTCTTGGCAAAAAATGGGTCGAACTTGTTGATCG
AGAGACTCAAAACACCTACTACTACAACGAAGTAACAGGAGAATCGAGGTGGTCTCTTTCACCTCGCAGTGCTCGCGACACTTCCGACACGGAAGATCAA
ATATCCTTGGCTTTGTTCACCCAAGTGAAGCAACTTCGTGAGTCTCCAGTGCCATATTCATCACGAGACCAGCATATGAGCTGGCTGGAAGCAGCCATCA
CCGAGAAGGACTGGGTAAAAGCTGATGCGATCGTCCAGCAGATTTTTATCCGCGAACAGAGCCAAGTAGTGACTGAACGAAAGGCAAGAGAGGAAGAAGA
GAGGTTATCTGCAAGCTCGAGCAATGGCATTATTCAGGCTACCTCTGATCTAACTCCAAGCACTTGGATTGAGTACCGAGACGAAAGCAGTGGCGCCATG
TACTACTACAACCAGGAAACAGGAGAGACAAGCTGGAGCCAACCGTCAATAGCAGCAAGTCAATGGCAAGAGATGCAGGACAGCAACGGTACTACATACT
ACTACAACCCCGTGACTGGCGAGACTACATGGTCAAAGCCAGACAGCTAGAACCAAATACACTAAAACTGCTAACTTTATTCAGCAGTACAACTACTCAC
AAATCCTAGCAAGTATGACAATGGTAGCTTAGTCCAGTCCACCCACGCAGACCATCTTCGTCTCCTGATACTCCTCCAGACCCATGAACGAGCCTTCACG
TCCCAATCCAGACTGTTTGACGCCACCGAATGGGGCCTGTACGTTCGAGATGGCGCCCGTGTTCACACCAATCATACCGCAATCCAAAGCAGTAGCAACA
CGCCACGTGCGAGACAAGTTCTGCGAGAAGAAGTAACCTGCAAGGCCGGCCTCCGTTCCGTTGGCCATCTCGATCACCTCTTCTTCGGTTGAGAACTTGA
ACAGCGGCACAACAGGCCCGAAGATTTCCTCGCTCCAGACACGCATCGTGTTATCAACGTGGGCCAGCACAGTGGCCTCGTAGAAGTTGCGTCCGATGTC
GCTGCGCTTGCCACCAACAAGAGCCGTCGCTCCGTTCGTGACGGCATCTTCCACCAGTTCCGACGTCTTCAAGAAGGCGTTGGGACCAATCAGGGGCCCA
AGCTTCACGCCTTCCTCACGAGGTGGGCCCATCTTGAGCTTCTTGACACGTTCTACGAGCTTGGCCGCGAATTCGTCGTAGATGTCGGCGTGGATGAAGA
TGCGGTTGCTGCACACACACGTCTGGCCAGTATTGCGGAACTTTGACGCCATCAGTCCATCCAGAGCCTTGTCGAGGTCGGCGTCTTCGAACACAATGAA
CGGGGCGTTGCCGCCGAGCTCGAGCGACACGCGCTTCACCGTCTCGGCCGACTGCTCCATCAGCAGCTTGCCGACTCGAGTGGAGCCCGTGAACGAGATC
TTGCGGACATCGTGACTGCTGGTTAAAGCTCCACCAACCTCGGCAGCCTTGTCATTGGGGGACGGCACCACGTTGATGACACCGGCCGGGATACCGACGT
CTTCGGCCAATTTGGCCAGTGCTAAGGCGGATAGTGGCGTCTCGGCTGCTGGCTTCACCACAGCCGTGCAACCGGCTGCCAGAGATGGGCCTAGCTTCCG
AGTGATCATGGCCAGGGGAAAGTTCCAGGGCGTGATGATGCCGCATACGCCCACAGGCTCCTTGATGGCCATGATCTTGTGGTCGGGTGCCGATGGGGAA
GGCAAAAAGCCATTCGAGTGCATGATCTCGTGCGCGTAGAAGTCGATGAAGCCGGCAGCGTAGGCCACTTCGCCCTTGGCTTCAGGTAGTGGCTTACCGC
TCTCCACGGAGGCGATGGTGGCTAGATCATCAGTGTTGGCCACGATGGCGGCGTGCCACTTCTTGAGCAGCCCGGAGCGAGCCGCGGGTGTAGTTTTGCG
CCATTTCTTCTGGGCTGCCAACGCCGCTGCAATGGCCTCGTTGGTCTCGACGCAGCCCATGTTGGCGACGCGCGCAATCTCCTTGTCGGTGGAAGGATCG
ATGACGGCGAAGTGCTTGTTGGAGTGAGCCTCGACCCACTTGCCATTGATGAAACCTGTCGACTGAATAAGCTCCTTGTTGTGCACCTCAGAGTGGAAGA
AGCGGCGCGAGGCGGCCGGTAATACGGAGCGGTGGATCTTGGACGACAGCATGGCGAACAAGGGCTGCGCTTGAGCTTGGCGAGGCAAATTTGTAAGTAG
TGAAGGATGTTGAACAT