Description :
From Genome Similarity Track
Location :
Scaffold_1383:280- 4395
Sequence
4115 bases(100 bases per row)
GAAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGATCCTAGCTTTTCATGGGGCCAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAAC
CAGAGCCGTCGGGTTTAAGCTCGCTAAAGGATCAACTCGATCCAACTGGTGGCTTCCCCGATACCAGGGTACCTGATCCCACGAAGACAGAAGGACTGAC
AGGTGAAAGAGGGTCGCGGTGCTTGGATCCAATGGTGGATCCGACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACTCGCCGAG
GATCTCGGGGAAGGCCTGGCGGTAATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATCCAGGGGCAAACGAGCCCG
CGGAAGTGGATCGGTTACGTCATAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGA
CATCGATGTCGGCGACGCGAAATCGATCGCTCAGAGGGTGACGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGCCTGCTGCAAG
CCAAGATCATCAGTTTCCCAACGTCCCCGTGGGCATCCCCAGTGGAAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCT
GGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATG
GCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCTAGTGGAACCGGATGCCGTTTG
GATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATTCACCCGAATACCGGAGTCCGAAAAGGGTGGGTCTGGGGAAGG
CCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGACCCCGTCTGTGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGG
CGGAATCGTGGGAATAGCTGTGCGAAAGAGTGGTATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGAT
GCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTATCTTCATTAGCCGATTTGTCCTTCCCACAGTCG
TTACGGGTGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGATCGG
TAGATTTCGCTGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGAC
GCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAATATGGAACAGGCA
GAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCGGAACGTCAACCTA
CGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGTTCTGGTTCAAGAACATGAGGGGATCTGCTATCCAGTCACATTCGTCAGCCGGACACTGAA
GCCGAATGAACTAAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGACCCATCCGG
AACCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTTAGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTG
GAGATTGTGAAGTGTTCGAAAGGGGAAGACGAAATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATAGATGAGGCGCTGACTAGGATCG
CCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGTGT
ACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGAGACAGATCCACTTACGCAGAAGGCCTCACCGTCAAT
GAGGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTAACTAAAGGGACAAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCCAATTTGGTAATCAGAC
AGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGATGGTTGAATCACGAGTTGGTGCA
TGTCAAGCGAGATTGGAATGCCAGTGCAGACAGCTTGGCCAGTGCCGCTTTACTGAATCAATGTGGTGTCGAAGTGGAGAGAGAAGCCGGGCATCAGGAT
CTCGTTACATTGAACCGACGAGACGAAGTGGTGGTAGTTGGATCCAGGAAAAGAACGGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGAT
CCAGCCCCCAGATCCTCGAGGAAACATTTGTGAAGGGAGTCCGTATTGAGCGGATCCTCAAAGCACAAAACGAGGAAGCGTGGATCTTGGGACTAAAGAA
GTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACTAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTC
TATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTACCATG
CTAGCCTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGAGGACTATTCAAGAGCGTACAACGATATGT
CGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCC
ATGGATCATATCCCCTCGTTGCCCAGCTCGCTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATTTGTTTACCGGATACGTGATAGCCAAAGCTAGTG
CGTCTAGAACTGCGCAAGCCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTT
TATGTCTGATTTCTTTTGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATG
GTGCAGACAATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAAGGATTGGGATGAGTACGCAGAGCGGCTTCCCTTCGCGATGAACACCG
CCCAAGACAGGATCCGGGGTGATACCCCATGTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTTTGCAGCACCAAGAA
GAGGAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACCACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGGT
CGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAGGGGTATGCCCCGC
AAATTGGCCCATCTATAGCATGGACCGCTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGAAAACGGCAGGTACCGAATATCGCCTGTTCC
CTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGTCCGCAGATCCGTCTTTCGGTGGATGAATCCGACAGGGTGGATTTCGACGA
AGTCCTCCTACCGGA