Description :
From Genome Similarity Track
Location :
Scaffold_1497:280- 1334
Transcript NameFunction/comments
g16774.t1hypothetical protein

Sequence
1054 bases(100 bases per row)
GAAGCGTGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGT
AACCTGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCCGGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCG
AAGGCGGCCCTCCCATTCGCTATTATTATAATACGAGACCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGAC
TACATCACATCGGAACTAGCCGAATGAAATCACTGATGCTGATTGGACAAAATAAACCGCCTTTCAACGACTTTTCATTTCTATTCGTGGTCGAGTTTCA
GAGAGATTCCAGGCAAATTCTCCCGGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACGGCGGCCACTTTTCCAT
ACGGTGTCTGACAGAGAACATACGGCTGCCACGTCCGATAGTGCTGCTGAAATGGTTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACGCG
AGGTACACAATGATCTGGGGAATGACTACATGAAGATTCCACGCGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGTCC
GGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACC
ATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAGAATATGTGTCCACGGACTCAGTGG
AGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCC
GATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACACG