Description :
From Genome Similarity Track
Location :
Scaffold_2120:28- 5902
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2120-snap-gene-0.2Conserved gene of unknown function
Pytar_ATCC12531fgenesh_masked-par_contig_2120-abinit-gene-0.6Gene of unknown function

Sequence
5874 bases(100 bases per row)
GGCTCGAGCCGTCATAACACGATGCAAGAAACATCATGGGCTCGTAAAAGCCTGTGACGGCGTCGGCACCGACGTGGCCCTTTTCCAGAACGGCTCCTTT
TGCAAACCGAAACTTGGCCGCCGACGGAATCTCTTGGACCAACTGGTCGTATCCTGGAAGAGACTTGATGCGGTCCAGTGGTTGTCGCCAATGGCTGGAA
AAGGGAGAGAACGTTTCCCATGGGTGCTACGTACAATCCAGACAAAAGGGATCAGCCGTCTCTCCAAAACAGGGGAAGACACTCACGCTTCAGCCGTACA
TGTGCAGCGAGTAGAGCTGTCTCGTTGGACCGCTGACGCGACTGGAAGAGATGGCGCTGAAACTTGCGCAGCGTCGGATAGACATCGCACAGGAACTCGA
CCGCGTCGGTCGTGTGGGCCACGACGCCCATTGCGGTCTCGTACGGCGACAACCGGTACATTTGCAGCGCCACGTCCGACGCGATCGGCGGCGCCANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAACGACTATCACTCTTGCTGGCGTTGCGATCGTCTCGGTCGCTCGCGCTCGTGCTGGCGCTGGCGCTGGA
GCCATCGCCGGTGGACGCCGACGAGTCGTTGACTTGGTGCCAGAACGCTGGGCCCGGGAAGAACGTCTTGTCGCTGTCTATCCACCGCGACGCCGCGTCG
ACGGATGGACCATAGACGAGCAGTGGCAGGCCTCCGTCGTGGTGCTGGTGAGAGACGATGCGGCTGAGCGAGGAGACCAGATAAAGAGAAAAGCGTCAGG
CCAGGGGTGCTCAAGACAACAGACCGAGTGGGCAACCTCACCGGAACTGGTCGGCCGCACGGTCAAAGCCGTCGTGCGCAACGGCCTGCGCGGCCAGCAG
CGCGTCCGCCGTTTTCTGAGGAGGCAACATTCAGAGGGGTCTTTTGGGGCGGTGAAAGGAAAGACAGCGAAACGCACCAAGTACTGGAAGCCGACTTGCG
CCGAGCTGCCGGGCGCGACGGCGCCCAGCTCCACGTCGAAGCGGTTGGTCAGCAGTGCGCGTGCGTCCGCCACGAGCGCGCTCTCGTCGCAGCGGCGCGG
CGCCATCAGAGAGAGCGACGCGAGGGCCGCCCACACGCCCATGGGCTCGGATATCCTTTCTGAGCCAAATTGAAGACGTAGTTCCTTCGTTGAGTGATAG
CATGCTATAGCAAAGGGATGTCGAGATCCCCTCTGTTCTAAGGCACAGGAGAACCCTATAGTAGAGGCAATGAAGACTCAATCTTGAAAGGTTGTTCGCA
ATGGACGCGGGCGACATGGCGGCGCCTCACGCGCGTGTCCAAGACACTGCTGTGGGGATTGTACCGCTGTCTGTACGTCCGATTGCTGGCGAAACTGACC
CACTTCTGCATGTCTGTGGCTAGTCGAAATGGAGCTTCCACACGCTCGTTGTCGCAAGCGGCGCGTCGACCATCGAGACCACCAGTCGCATGGAGCTCCT
CGCGTCTCTCGCGGGTGACGCGCAGCTCACCATTCCTTCCCGCTACCGCAACTCCTACCGCATCGTTAGGCGCCCAGAGGTAGAGGACACCGTGCGCATT
CTGCATATAGAAGCCGTGCAAGCCGAACGCGAGGCTGCGGCCGCCTCCGACGTGCAAACGTCAGGTAGCGAGAAGAGTGAGCAGCCGACGGTGGCGAGCA
CTTCCTCGCCAAGCATTCGCGCTGGTTCCCACGCGCTTGGAGGCGAGGTTGATGTCGGTGTAGTGCCGCTGACTCCGTCCGCGATGGCGCTCGCCTTCCA
GCGGCTCGTCGCGCTCGACAAGCAGGCGTGGGCGGAGACTGTCGCCACGGAAGGTGGGGGAAACACATCTCCACCACCACCATGTCTAGGCGGAAATGCC
ACCCGAATCTTTCTCCTGGTCGACTATCCGTCCACAGTCGCGGAGGTCCAGGCGCTGCTGCTCACACCGGAAGCCGGCCAGACGACGCCGCACCAGTCGG
CCCCAGGCGTGCCGCAGCTACCGCTGCTCGACGGAGTACTGCTGCTTGTCGATCCTGCGCTTGAGCTACGAGAACGTCGCAAGAGCTTATCGCAAACCGA
CGAGCGCCGCAAGAGTCACACAAAGCGCATCTCTGTGGAGGGTAGAGAAATCTTGGAGCTAGCCGACAAGCAGCCCGCCGTTGACTCAATCTTCCAGACC
GCGAATGCGTTCGTGCGTAGTCTCTACGAGACTGCGGCTGTCGGCGGACTGGAGTGGAGCGACTTTGAGTTTGTAGATCTGCCGTGCTGCTCACCTACGA
ACGACGTGACGTCAGCGATAGACCTCATCCGCGACCTTGAGAAGACGTTGGCGACGCGTGTCGCGCAAAAAGCTGCCTTCAAAGACTGGGTCTCTTCTTT
CACGACGGTGGCATTCCCCACAATGGACGGTGCGAGCGTGGTTACCCAGGCCGCAACCGCACAGTACGAGCAACTACTCCATCCTGTGTTCGAGCCTAGC
GTTAGCGTGGCCTGCATCGTCTGGGCCATGCGGGAAGCTGTCGTTCGCAGTTCTGGAGAATGCGGAGACAACTCTACTTGCGCCGTGAGCAACAATGTAT
CTGTTCCAGAAGCGTTCATCGACCACGGTGATGACGCTGCCTTGGGCTTGGCACTCAGTTACGATCTCTTCACCAATGAGAGAGTCCGTCTTGATCTCCC
CTGTGAACCGTGCTGCGTTGGTGATGGAGAGCGGATTGACGCAGTCGAAAAGGCGATCTGGACGAGCTGCGACCTGCCTGGTGTGGGAAACCAAGGACGA
AAGGCCATGCCTGTGTGTCCGCAGCACTCAGACGCCGAACGAAGCGTGCTGGACACGGAGTTTGCCTCCTTCGCGGCCATTCCACTTCCCCGCGTACATC
TCATGCGCCAGCTTCTCCGCGTGGAAGAGCTGCTCGGTCAACCGTGGAAGGGCAAACTACAAACACGAGACGTGGTCGAGTCGCTCCAAAAAGAAATTCT
CCCACAGCGCCTAGCAGCAATCTTGCGGGACAATCCTACGGTCGTCAAGGACTATGATGAACCGACCGACTCACTGCTGGTCGCTGCCATCATTACAACG
GCGCCTGGCCGATTCCGCACCACAGCGTGGACAGCACGCGACCACGTACGCCACCGTCCGGCACTGAAAGACTGGCACCGCGAGACCCTTCCGTCCGACG
AGTACCTCACACCACGCACCGCACTCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCGCTGTCGGCCGGGCAGCTCAGTAGCGTGGCCG
AAAAGTGCTCGATCGCCTACCCGGCCGACCAAAGTATCATCAAGCTGTATCAGTCGCCCCATGCGCCGGCGTGGTTGAGCGTGTCACTCGATGGGTACGC
TGTAGAGATGGGTGTGGGGTAGAGGTTTGCTTACTCACCGTTGGCTTCTGTGATGTATAGCGACGTATTTGGCCTGCGTCCACGACCTTCGTCGTCCGCA
AGTGATTCACCACCGCGTAAGCGTTTTGCAATGCGGTTCTATGCAAATCTGGCCGATCGATCGCAAGTGCTGATTCGCGAAGGACGCGAGCGACCACGAA
AACCGGATCGCCATGCGAGCGTCTCGATGTCGCTCACGACACCAGACGGCCTGACGGTCACGGCGTGTTCGGACGGGGCGATCGTCCAACAGCGTCATCG
AGCCATTGCCTCGGAGAAGAGGGTTGTGGATGAGACCCTTCGTGTCATCTCGGGCAAGGGCACCGTCGTGTGCGTGCTGTCGGACGAGTCACGTCACGTT
TTGCTTCCGAACGGCGACGTTGTGATGTCTCAGACTGGCAGAGATGTGGTCACTGAGCCATTAGAGAACGCAAACCAGCGGCAGCTCACAGTGGACCCGG
AAACCAACGCGGTCGTTGATACGCGACCCCTGACGGGTGTCGTCGTCGTGACCCATACGGATGGTTCGCGGGTGACGTACCACGCAGACGGCACGACCAT
GTACTCGACCCCCACGCGTTCCCACGTGCTGATCACGAAGGCGGGTCTCGCCGACGTCTGTATCGATGTGGACGTCAACATCACGGCCCAGCGCCACTCG
AACGGCGAGAAAGTGGCCGTCACCAAGGGCGGATTGCGTACGCGCAGTATCATTCGCCCTACTGACGGGACGGAGATCCAGATCCAGTACAACACCAAGG
TCGTGGCCGAAGTCAACGGCCGCATCGTCATGGACAAACTCGATGGCACCAAGATCGTAGCCAAGGACAGCGGCCGCGTCGAGTTCACCCCACGCCGCAC
GGCAACGGCACCCGGAACTCCGCTGCAGTCGGAAAGCGATGAGGACGCCGACCGCGACGAGCTGAGCCACAACCGCTTGTACTATTTCAACTGCCGCGAC
GGCTCGCTGGACCTTGTCGACCACGAGCAGAACCACTTCTGCGTGGATGTGGGCGACGGCAATAACATCACCTCATTCAAGGTGGACCTCGCGGGTGTCC
TCAGTGGGAGTGATGCCGACAAGTATCAAGTGGAGCCAATACCAGCCCGAGCGATCATTAATGATCCTATTGAACCGTTTGTATTTGTGCTCCACGGCGA
CGGCACCGGCCGCGAGCTGCTGCGGCCTCGCGACGTGCGAGATTTCTTCGCTACTGACACGCAAGCTGCCGTAGGCGTGAGTGAGGTATCCCATCATACA
ACCCCTCCACCACCGCCTCCACTGTCCGCCGCTGGTAGTGGTGGGGACTGGTGGACTAAGGCCTCGCTGTGGGCAGCGGAACGAGTGTTTGTCCAGCAGC
TACGACCGGATCCACAGCTAGCAGTCACCACAAAGCGCAAGTGGTTCGCTGACGAGAAGCTCACGTCGTGCTTCGAGCGGCTCAAAACGCCTGTGGCGAC
TGCGTATTGTCTCGTCACCGAAGCATGTTTGCCACCGCTTTCGGTCCCCAAAAACCAGCTCACGATCGTGCGTCACCTCGAGCAGCTGCGGCCGATGGCA
AGCGACAATGTGGTCGATATGCTGTCGACTTTGGACAAGTGGCGACAGTGGCAGACCGCACGGGAAGCCAACAAGGACCGATTCAAAGTCGTGGATCCGC
GGGATACGGAGGCGCTTGCTTTAGAACTGGCCATGCAACGCAAAGTCGTGGCAGCCTACAAGGCGACGCGCGCCCGCAAGAAGGCCGAGCGACAAAAGCA
GCGCGAACTGCAACGCAAGACGCGGGTTGAGAATGCTGCCGGCAACCACGTTCACATGGAGACAGTACAGGAAGGCAACGAGCCGCAGGACGGAGACCAC
GGAGATGATGATGAGCTCGATCAATTGTTTTCGGAATGCACGGACGACGAGGACAGTCATAGTGATATGGACGTCGAGGTCGACGATCCGGATGAACTCA
TGTGGACTGCGTTTTCGCACGCTGACGCAGGTGACAGTGGGCGACTGACACTCGCGCAAGGTATGGGGTCCTTTTGTGTCTGCGTTTGTTTACTGTTGGT
GGGAGTAAACTGGCTAATATGTGTTTGGATGCAGCTCGCCACGCACTCGTACAGGTCCTAGGTGTCGGCGTGACCTTGGTTGAGCTTGCCAGTCAGCTCC
GCGCGTACAAGCAGCTCGAGCCTTTCTCGGTAGGTGTTTTTCTGTGAGTCCTTGCGTTCTAGAGGTGCTGAGGATGAGCTTTCGGCAGGTCTCGTTCGAT
GTCTTCGTGGATCTCGTCCACGCCTTGCGTGGCGAACAAGATCCCCCTGGAGATTCTCCTACGGGAGGACGAGGTGGAGGGAACAACCATTCACCGATGG
ATTCCATGCCGCCTGCTTACGGCAAGCAGCTCGCAGTAGGCTCGGCGACCGAGGCCGTGCGGTCCTTTGCGCTG