Description :
From Genome Similarity Track
Location :
Scaffold_2301:28- 3061
Sequence
3033 bases(100 bases per row)
AACTTTCACGAGAAAGAATAAAAAAATCTCTCTTTCTGGGACGTGAGGCGCGAGATGGCCATGGGATCGGCCCTGCTCAGGTTGAGCATCCGCGCGTGGC
GCTGGCTATCTTCAGGCTTTGAGGTTCGCGCTCGCGAATGGGCACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGAGATCAGCTGAAGCA
ACCGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGTATCCGGTCGAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGAGTTATTGGACTATGTT
CAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTCTTCCAGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTC
GAACGGAAGTGTTCCGTGTACACCCTAACTCTTTCGAAGAGGCGGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAG
CGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACCTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTACGGAGCAGCGCGCCGGC
ATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGCCTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCAT
CGCCGGGAAACGACAACTCCCAGTAGGCGCGGGGCGGCCTACTGGGGTAGAACTGAGTTCTGTTGTGCCTCGAAGAGGTAGAGGACAACGGGGCTCAGCC
CCGAAGAGAGCTGAGCTCTCTCACGAGAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCT
TGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGAT
CTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTG
GTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGAACGCCATAAGCCATGGATCGACTGGAAGTCGAAAACGCTAGGTGCGT
CGCACCCTGCTCTTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGT
GCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAG
GTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGACC
CGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCTCAGGAGATGCAGGCGAAGTGACACTAGCTCACTGTGTGAAGGTCAAGAACCTCTT
GGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTGCACCCGGTGATGGTGATGGAGATGTCGCCACATTGCCCT
CATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGTCGAGCGGTGA
TGCTCCACGTGATTGCTGTGAACAGCTGTATCCACTCGTTAACGGGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGACACTCTGCCCGCTGCAGACG
CTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGTCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCCTGATGGGACCTGAGGAGGCGTT
GAGCTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCC
TTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACGGGTCTGCCTCCGGACCGAGGCGTGTGTCATGAGATTGACCAGGTTC
CTGGAACCAAATACTGCGTAACAAGGCAATGGCTTTTGCCGAGAGAGCGGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGT
GCGCGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCC
ACTATCCCGGCGCAAAACGCCGATTTCTCGCAAGGATGTTCTGCAAAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGATGGCTAC
TACTAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGA
ACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGC
CGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGC
GTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGG
TTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGA
TCTCCTTAAGAAGGACGCACCATGGTGCTGGAA