Description :
From Genome Similarity Track
Location :
Scaffold_425:28- 2766
Sequence
2738 bases(100 bases per row)
GCTTCTCGGTCTTCACGACGGCACCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGT
CGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCAT
CTTGGTTCTTGCAGTGAGGATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCC
CGCGCCTACTGGCGTCCAGCATTTTTTGTTTGGCTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGTG
CAAAGTGACCGACTCTACCCCAACGGTAGCATCGCACATTGTTTCCCTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGG
GCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGGAGGCTAAACTCCTCCTGCATTGCAAGAGTAATT
GCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGA
TCGGATTGGTCACGATGTTCGAGACCAAGTACCATGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGA
CCGGAACTCGTTTTGCGGGGGCTCAAACGCTTGTCTGAGCTCTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATAC
GCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGCGAACGCGACTGACACGAGGCGGTCCCCAGAAAATTGCCGACGATGTGCCGTCACCTCTGTGA
CCTGGAGTTTGTATCGGATGCTGATTGGTGGATGACTGGGATACGGCGCGGCTGTACCCGTGTGACATGGACGGCGACCGTGGCAGAGAAGTGATTTCTC
GGGATGAATCCAGCGTCTGACCGCAGATGGGCCCAACTGGCTGGAAGTGTGAATCCTGGGAGTGCACGCCCAGAATTTCAGAGAACACTCAGTCCAGCCG
CGGACTTTCCCTTACGATGAGTGCCTAAAGTCTGGCGGAAAGTGTCTCTGGAGAATGAGTACGCCTCATCTTGCTGTGGCTCAGAGTGCCCCAGAGGATC
AAATTACCCTGAGAATCAACCCACTACTACCATGATCATGAGCAGGAGGCCGCTAAACCCACTAAAAGTGTGGCTTTGAGGAGATACACACGAGTCTGCA
CTGCAGCAGATTTGTTACCTAGAGTGCCGCACGGAAACCTAGAATGCCGCACGATGACCCAGAGTTCACCTCCCTGAGTGCAGGTGACCCAGAGTTCCAA
AGATGATTCTCTGGGTTTGGACCATAAATCCAGACTCTCTATACTGAACTTAAGTGTTTCCCGAGCCAACACCCAAGAATCCCCACAGTTCCCCAAGATT
CCTCAGAATTCCCAGGATTTCAGAAGATGACCCTGAGTGTCACCTGGTTTTCAGGGACTCGAGTCAGTTCGAAGCCAGTCTGCAATCAAAGTGATGCGTG
ACCTTGAAGAACCGTTGTGGATGCACAGACTGGATACTTTCGAGGAGTCGAGAGGGAGTCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAGCTAGGAGGGCATTTG
GGTAAGGTGTCTTCTGAGTTCCAAGTCCCAGAGTTGACTGAAAACCTGGACCCTGAATTCGTGATATTCTGGGTTTCAGGGGATCTGATTCTCTGGGTTT
GCCTTTTGGTGTGGAGGTGCGTTCTGAAGTAGACGTGCGCTCCCGCACTTCTTCGAGGCTACATTTTCAACCGGTGGAGTGCCGTTCTGTCGAAGACAAA
CGAGCCGACAGGGATTACACAAGGTACCCACGCCAACCAAGAGGAGTGAGTTTCAGGGTTTAAAGTTTTGCAGCTGCGAATCTCTGGGTCTATCTTCTTG
CTGTTGACTCTCAAGTCGATTCTCTGGGTCTACCCCTG