Description :
From Genome Similarity Track
Location :
Scaffold_1645:28- 2624
Transcript NameFunction/comments
Phyin_T30-4PITG_22069Arginase%2C putative

Sequence
2596 bases(100 bases per row)
TCCAAGATTCCAGGCTTCGAGTGGCTCAGTAATGGCCCCAAGATGAAGCCGGAGCAGCTCGTGTACGTCGGTCTGCGCGACGTCGACTCGTTCGAACGTC
GCGTCATCCATGAGAAGGGAATTAAGGCGTTCTCTATGCAAGAAGTGGACCGCTACGGTATTGGCAAGACGATGGAGATGGCGCTGGACCATCTTTGTGG
CAAGAAGCAGCGGCCTTTGCACATGAGCTACGATATCGACGCAGTGGACCCACTGGTGGCTCCCTCGACAGGCACACGTGTACGTGGTGGCCTTACGTGG
CGTGAGGCTCATTACGTCGCTGAAGCTGTGGCGGAAACCAACTTGATGGTGGGTCTGGACATGGTCGAAGTGAACCCGACGCTGGCACCTGGCGATGGAG
CTCAGATTACGGTCGACATGGCGCTCATGCTCATCTCGTCGGCGCTCGGAAACCGCATCTTGTAAGACAATTCTCAGTTTACATGGGTTCGTAGGTAAAT
TTCACACCTCGTTTAGCAATAACGAACCCAGACACGACCACAATATCATGAGCAAATTGCGTTCTACACTACCGCTTGCCTTTCTTCTTGGAGCCGAGCG
CTATCCGTTAATGTCAAACACATTACACCGTTCACGCTTAATTAGTCGTAGCTAGCAATTAATCGTAGATTTGCACTTAATTGATATCACAAATTCGAGA
TATTTGACAGATATGATCAAATCTATATAAAAAGACCGGTTTTGAGTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTGCTCAAAAGAGAGCGAAGTGAC
CTAATTAAGGTAGAATGTAAACGGAGTATATTTATAGATAGATAAAGCTTGGGTTTAATACAAACTTTTAGTCACCTATATGTCGTCAACCCTTGGTTCT
TTGTACCGAAGTATGACGTGTCACACTTCATGTAACCAGGGTACATTTAGGGCGACGTACCCCGTTACATCCTCCCCCACTTAGGTTCGGTTTACCGACC
AATCAGAATGAAGAGGTGTTCGTCACAAACCTTCATTCTCAAAGTCGAAAACCATCGACTTGGCCGCGGGAGCGTGGCGGAGGCTCACTTCACCGTTAGA
GCCTCGAGCAGCAGTTTGTGCGCTCTTCTTCTAGGTCTCCACTTCGTTCGTTTACCATGCCTCGTGGCACTGCAAAGAGCGGTGCGAAGACACGCTCCAA
GGCTGCTGCCGGGAAGGCGCAAGCCAAGAGCATTAAACCTCACGGCAAAGGCTCAGCACTTAAGAAGGCTACTCAGGTGGCCTCCGAGGCGATCGGCTCA
TCGGGCGACAAGGTTGTGGGCAAGCGAACCAGCAAGCGCCGCAGTCCGTCGCCCTTGGCCTCTCCAGACAATCGTCCGAACCTCGGTTCGTAGAACGTGA
GCTCGACTCTGGCAGTGAGGACGGAGCCGAGTCCGAGAGCACGCACGATGCTCCTGCGGGCTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN