Description :
From Genome Similarity Track
Location :
Scaffold_3787:28- 2085
Sequence
2057 bases(100 bases per row)
GATAGGTTCCTCGTGTCTAATAGCACCTAAAGTCCCCCCACTTTTAAATACACTTTAGGTTCCCTCCTTCCAATGTTTGTCTGAGGAACTCCTTTTTGTC
TATGCCTGGGCCGCTTCCATAGGCATCGCGGGACCCTGCTGACAATGTTCAAGCTTTGTATCCATAAAAGATTTCACCTGGTTCCGCAGCGAAACTGACC
TCACCATCCGAGACCTGGGAAGGAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGT
GGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACG
TGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGC
AGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGA
ACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTCACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAA
AATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGA
GCCGAAGAGTGCCCTGCGGGTTTAACCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAG
AGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGACCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGTCGAACTTAAGATTCTCGTCGTTGGGTAC
GACCACCCGTAAAGGATCAGTTGGCTTCACCCGGTAATAGAGAAGGCCATCCTTTAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAG
TCGGACTTCGCGCTCGTTCCTGCCATAAGGAACTTGACGATAGGCGCGACAGCCTGATCGTCCCGATACGCCATGCGTATCCGATCATATAGATTCGTTG
TCACCCGCGTGATGTGGGCCAACTCATAGTCAGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTA
CTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGCGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACGAAGGGC
CCGAGAACCCAGAAGGTGAACACGAAACTTCACAAGGGCATATTTCATTGCCAGGGAGCTTCTTGTCGTGGACAGAGTAGTTCCGCTCGGCGGCTTTGAG
TTGCCTGGACTGGAACAAGATGACTCGTTCGTGTCCAGCCGTGTCGGCCTGCAGCAATGCACATCCGATGGCGTAATCCGAGGCATCGCAGACGACGCTA
AACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTTTGGGAGAATGGCCTTGGATGCTTACAAAAGAATTCCTGAGGTTCCTGCTTCCAGCGCCC
ATTCGACGTCCTTTTTGAGGGAGCCCCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGGGAAGGTAGTTGGCCAAGCCCAACCACTTTC
GAAGATCCTTCTGGGATCGGTACGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGATCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACT
TTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGTGTACAGCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCT
CCATGGCCGTATTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACG