Description :
From Genome Similarity Track
Location :
Scaffold_1089:28- 1453
Sequence
1425 bases(100 bases per row)
GTGCGAGGCGCTCAATCTCGAAATGAACCCAACTCATATCTCATTTCTGATGCTGAGTAAACTCCATTGGTACACTGTGCCAATCAGACTTCTTTCAGAG
TCGCCACGGCTGTGGCTCGGCCGTAAAGAGATTTCATTGTGCTTGTCCATATCATCCCAACTCGTCACCAACGCCCAATCGGTCACGTGTGTTCATTGGA
GACTCTACCATCCATTTCCACAATGATGACTGATCGCTTGACCTGAAACTCAGACTGCACATGCCATACCCACTTGAGACAACCCGTCCTCTCCATCTAT
TGTACGGGAGATATTCTCATCCATTTCGAGTGTTCTCGCTTCCTGCAGCAGCAAGACGCGGTAGGCTGTCAACGAAGCAGCTCTTGAAGGTCGACTCGGA
TTCATGTCCGGTGCGCACTTGCAGAAACGCCTGCGACGAGTCATGAGAACGAAAGGCAGATCGCTTTTGGTTCTCAAGCTCGCGTGCACTGCTTCGAGTA
TCGACCAGCTGTCGTACTTGGAACATCATTTGATCGGTCCTCCAAGTTGCTACAACCGACTTCGTTGAAATTGGTACCATCACAATAGCGTGAACATTGT
ACGACCACTTGTCACTGCAGCTTTCGCTCAAACTGTGGTTGCCAATGAATGCAGATCATGCAGCAATAATTGATGTTCATCCACATGTCACCACGTTCCG
CGTCGCTTTCAGTTGCTCGTCTTCTTCTTGATACACCAACTCTTGAAGAATCTCCACCACATCCGATAGCTTCACTATTTCCAACAGCTCGCACACACGC
GTGCTCGACACACACGCCTCGCCCGCCATGTTTTTCGCCCATTGAGCATTTCTTTTGCCTGGAGACATCTCGCGACAACCACATAGGCATGAGCCACCAC
AGCGGCCGTTCTATCACTGCCTCCACGATGCACATACCCAGAGAATACACGTCGGCATCGAACGATGGTTCGGTCACTCCTTAAATCACGAACTCGGGGG
CTCGCCGCTGATCGGCATCCGATTTCTCGGCTTGTGGTCTCAACTCGACCGACACGAAGCTATAACCAAGGCAGACACCATGGATGTGCCATCATTGCTC
ACTGAAATGTTGTCTCCTTTACCAGGTTGCTCGTGATTACTGGCGCACAACGAATCAAAGCGACGCCATGCAGTGAGGGAGAGACTGAAATGCAGCAATG
TGGTAGATTCACACCAAACGTTCGACTAGAAACTCGGCCACGGACAGATGGCGGATATTCGACAAGGTGGATAAGCAGTGGAAGCATGTCCAAACCCACC
AAAAGCGCGGATAGGAGACCTACGCTCCACCGCGATCTGGACGATCTCGTGGTGACTGGCATCTACCGCAAGCACGAGCGGCGTCTCGTCAGCCAGCGCA
CCCATCCGCAGCAGCTTCTTCATGT