Description :
From Genome Similarity Track
Location :
Scaffold_805:28- 1053
Sequence
1025 bases(100 bases per row)
TCTGCGGGTCTGAGTGTCGTGACTGATACGAAACAACTCGCTCTCGACCTCATCATCGTGTGCATCAATGCGCACCGATGGCATATCGCTCGCATCACAG
ACGACGTGGAACGGCTGTCGTGATTCGGTAGAGCCAACACAGGAGCTTCACGAAGACTCCTCTTGACTTCTTCGAACGCCGTTTGATGGTCTTTCGACCA
CTTCCACTCGACGTCTTTCTTCAAGAGCTGTGTGAGGGGTTGCACCAACGCTGCATAATTGCGCGTGTACTTGTGCAAATAGTTGGCCAGACCCAACCAT
TGGCGTAGCTGTTTGACGTTCTTTGGCACAGGCCAATCGTCAATAGCTTTGACCTTCTCCGGATCGACCCGAACGCCATTCTTGCCAACAAAGCAACCGA
GAACAGGGATCTCGGGGGCGAAGAACATGCACTTCTTCAAGTTTGCGTAAAGTTTGTTTTCACGCATGACCTGGAAAACTTGACGAAGATGATCAAGATG
AACATCGACATCAGATCTCCCATTTGTGGCCTTACTATGAACGAAGATATCGTCGAAGTAACTCGGTGCAAATGTTCGTAAAGGACGAAGAACGTTCGTG
ACCATTCGATTGAAGGTCGCGGGTGCATTCTTCAGTCCCTGTGGCATCACTAACCATTCCCACAGCATACCGCTAGGGGTACTCACTGCAGTTAGTGGGA
CATCGTCTTTGCGCATTCGAATCTGATAGAATCCATCTTTCAGATCGATAGCACTAAAGACGGTGCTGCCAACCATCCCATCAAGGATCATATCCTTGCG
TGGAACCGGAGTCTGAGCAGGAATAGTCGCGTCGTTCAGCTTGTTGAAAGCGTGAACAATGCGCCATCCGCCAGTCGCCTTCTTCACACAAAAAGTGGGA
CTACAATGCGGAGACTTGCTCTCCCGCACATGCCCAGCCTTCGCGCGTTGCGCAAAGAACTCGTCAATTGCCTCGACTTGTTCCTTTGGCAACGGCCACT
GTCGTGTGATACAGTACTTCGTGCC