Description :
From Genome Similarity Track
Location :
Scaffold_39:279933- 281908
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011985Similar to B11B22.010: E3 ubiquitin-protein ligase TOM1-like (Neurospora crassa)

Sequence
1975 bases(100 bases per row)
GTCGTAAACCCGTACAATTCGGTCTCCAAGGCAGCATAGAGCACGGCCTTAAGGTCGTCGCGAGACACATGGTACGGAAGATCCAATCGATTAAAGCACG
CGTGGCTCCAAATGTAACCATCATCTTTGAGTGGCACGCCATTCAGTGTGAATGGACACAGTCGTCCATCATAACTCGTTAGCGAACTGAAACCTGCGAT
GGGGACGCGCGACGAACCCGTTGCAAAGTGTAATAGACGCTGACGGTACTCGTTCGGCATCTCGCGGACCAGCTCCCAGAACCAGAGCAACGCTGGGTGG
TCGTATGCAATGTTCGAATACTTGGCATTTCGCTCCCAGTCGTCGACGTCGATCTCGTCCGAGCCACACAACAGGTAGTCAAACTCTTCCGGATCAAACA
GCATCAGCAGTTCCTGTGGAATCACTTCGTAGAGTCCTTTCAAGAACACATACAGCTGGCTGGACACGCTCTCGAAGAGCATGTACCGGAATCGTCGCTC
AACGTACTCGTCCTTGTTGTCGTCGGTCACGTCGATGCTGCGGCCATTGGGGATCAAATCGACCACGACCACCTCGTCACCTCGCTTCTCTGTGACACTG
AAATCAAGACCCAGAGCGCCAGCATCGTCGTTCTCAAGCATCCACAGTAGGTTCTTGTACGTCTCGGGATCAAAGTACTCGAGATCGGAGAACGTCACCG
GCAGTCCCAGAATGCTCTTGACGAGCGGCAAGCACAGATGGAAACCCAGGGCGTACCCTTCGAGCAGCGCACGCCCAACAAGCCGTCCCGTAGCGAAGAA
GTAGACCAAGTGGTTCTCACCGATATCGTTCTTAGAATTCGAGTTGAGGTAGAACGTCTGTTCTTCCTTGTTCACGCACTGAAATACGCCACAGGACGCA
CCAGCAAGTTGCTCGTTCAACAAAACGAACCATTCTCGGTAAAGACCTCCAGCATCAATGCCAACTTCGTCTGCAAACGTGATGCGCATCGCCGAACGGA
CGCTCGACACAGGGATCACACTCAAGGACTCCATCGAGTCTTCAAACAATTGGTCGCGGTTGACTTTTAGTCTCAGCAATTCTCGGACAGCAGGCACCGT
GATCACTGCAGTCATCGTCACGAAATGCGCATACTTGGCCGGAAACACCTGGGACGCCAAGCTCATCACGTCTCTCCACTGCAAGTCGGTATCTGAAGCC
AAAATCACAGAGAGGTGAGTTGGATCGGATGCTGACGATTCGACCAGCGTCATCGTCATTCCCGCCACCGACTTTAAAAGAGCATCGAGCACTTCCCCCT
TGGTAAGCAACTTGGCCAGTGGAGCGTCCGTTTCGTCCTGTCCTGCTTCGGAAGGAGCTGCTGGCTGCTCCGTATCCAGCGGTTCTTCAGATGTGCTATT
GCCTTCAATCTGATCCACGACGACGACGACATTATCTTTGCTTTCCTCGTCCTCGTCAGCAACAACTTCTTCTTGGACGGCGCTTTTGGCTTCAGAACCA
TTGTCGTTCTCGGCTTGGACAGTGTCAAAGAAGCGCACAAGGTATCCTGGGAATCTCGCATCAACGCCAACAATGTTGACACAGTCTCGATACCAGGCAA
CTTTGCCATTTCCATCCAATCTTCGCGTCCACTCTTTACGTTTCCTGTACATCAGTCACATATGAGTGGTTCATCTCGATCAAGTACGTCTTCAAAGATA
AAAACAGAGCAAAAAAAGGCACGAGAGCATGCAAATGCATCGTACCGGGCCCTCTGCTGCCGAGTGGTGGAGCGTGGGATCGCCGATGCGCGACTGAGGA
TCTCGATCGAGCCTTTCTTCCGCGACTTCCACAGTTTCTTGACGTCGCTTGCTCTCTTTTTCTTCTCGCGCTCTTCGTCGTAGATTTCGTCTCCGCACAC
GTTGCAGAACGCGAACCGCTTGAAGTTTTCAAAGCCGCAGAGACTGCACTTGTTGTAACCTTCCTCCGCGTCTCT