Description :
From Genome Similarity Track
Location :
contig_12:279844- 281187
Transcript NameFunction/comments
g3182.t1hypothetical protein

Sequence
1343 bases(100 bases per row)
GTCGCCTGCAGGGGCTTCTTATCGGGTCGATACCGAACGAACCGCGGGAACCGAAGCGCTAAACCTTTGCGAGCCGCAGCAGCAGAGTCACCGCCTGTGG
CTGCTTCGGTGCCACAAGTGTACGAAGGAGACTCGGTCAGTTGGGTGGCTTTGATCTCCCACACCTCTTCTGGCGAGATCCAAACATCAGGATGGCGACT
CCGAATCGCATGAGATTGGTATTGCTCCGGCACCTCGTCGGTCTCTGGCAGAACTTGCTTCTGAAGGCGAGCTGCCACTTCCGACAGCTGTGCATCGGTG
AAGCCTGTGCCGACCTTCCCAATCGTCTACGACAAAGCAAAACAAGACCACCATGAATTAGTAAGTATAGCGGTATCGGCATCAAACGCTTGTTCCGTAC
CTCGAATTTGCCGCTGGTCGAGTTGTAGGTGGCCATCAGAAAGGATCCGAACACGCCTGCGCGCCGGCCTTTGCCATAGAACGCGCCGATGGGGACCAGG
TCCAGCGTGTCTGCCAGGAATGTGCCGTTCCCGTTAGTTTTTGCTGCAGTAGGTTTTTGTTTTGATGTGGTCGGCTCATCCGATAGATAGTCATGCTTGA
GCTTCATCCACGAATATGACCGCCGGCCAGCTTTATACTCAGACGCTTCGTCATCCAGTGCCTTGATCATCAATCCTTCACAACCACTGGCCACGGCTTG
TTCAAGACACCCTCGTACATTTGCTGCCTCTTCACCTTCTCCAGAGTTCTCGCCATCAGTTGGAATCGTATCACCGGCCGCCAACTGTATGTCAACGTGC
TTTACGAACTCGACATATCCAGCCTCTTCCTGGAGCAGATCGTGGAGCAAGGCTCGTCGTTGTCGTAGAGGTTTCTCCAAAGGTTCACAGGACAAGAGAA
TAAAAGGTTAGTTGAATGATACGACACACAAAGCTCCCCATTCACATACCTGAAGGAGGTTGGTGCCATCGACAGCAAGCATATCAAAAAGAAAAAGACA
AAACTCCGTCGTGGACTTCGTTTGAAGCACTTGGAATGGGCGAAATGTGCCCGTCTTCCGATCCAATGCCACCACCTCGCCCTCCACTATCAACGACGAC
ACTGACGACGACCCTTGTTTTGTTGAATTGCGAGCTGCCACGCGCTGCTTCAAAACATCCAGAAGGGATGAAAACCTCTCCGTGACGTCCTCCATATTTC
GACTGAAAATCCGCCCGACTGAGCCTGAGCCATCACTACTATCTGGCAGCGTCAAATGCGCCTGCACTCGGGCACCATCATACTTGTACTCGCAGGTGGC
TGTTTGGCTTTCTGTCCTCCCCACGCGATCCAACACCGCCGCG