Description :
From Genome Similarity Track
Location :
contig_38:27984- 29733
Transcript NameFunction/comments
g7045.t1hypothetical protein

Sequence
1749 bases(100 bases per row)
CGTGCGTACCAGTTGCTAACGGTGGACAACTTTGATGCCGAGCCTCGCTCGGAAGAGGGACGTCGCCGCTTGCGTTTCTTTGCCAACTCGCTGTTCATGG
ACATGCCGGAAGCGAAGCCTATCCGTAAAATCCGTTCGCTGACGGTTTCGACACCATACTACAACGAAATTGTTATGTACTCGATCAAGGATTTGACGGC
ACAGAATGACGACTGCATCAAGCTGTTGTACTATCTGCAAACCATCTATCCATTCGAGTGGGAAAACTTGCTGGAGCGCATTCCGGCCAAGGACATGAAC
GAAGCGCTTAAGAAGAACCCGGAGGAGGTTCAGCTGTGGGCCAGCTACCGTGGTCAGACTCTGGCGCGTACTGCACGCGGTATGATGTACAACGAAGAAG
CTATTCGCTTCCTTCACTGGCTGGAAATTGGCGAAAACGAGCCGATGCACCAAGTGACGTGCTCGTGCAACAAGTGTTGCAAGTTGAACGAAATGGTTGC
CCTGAAGTTTAATTACGTTTGCACGTGCCAGATCTACGGTAAGCAGAAGGATGAGCAGAAGCAGCAAGCTCAGGATATCGATTTTTTGCTGCGCAAGCAC
CCGAACCTTCGTGTTGCTTATGTGGACGGACCAAAGAAGGTGAAAGATGGCCCGCCAAAGTTCTTTTCGGTGTTAATCCGGGCTCTGGACGATAAAATTG
TTGAAATTTACCGAGTGGAGCTGCCGGGTAATCCGATCCTTGGTGAAGGTAAGCCTGAGAACCAGAATCACGCTATTATCTTCTCGCGCGGTGAGCTACT
GCAGTGTATCGATATGAATCAAGACGGATACCTTGAGGAGGCTCTCAAGATGCCGAACCTGCTGTCGACAATGGATAGTGGCACGGAGAAACGCCCTTTG
ACAATTATTGGTTTCCGTGAGCACGTGTTCACGGGCGGTGTGTCGAACCTGGCCAGCTTCATGTCGATCCAAGAACTGTCGTTCGTATCGCTTGGCCAGC
GTATGCTTGCCCTTTTCCATGTGCGTCAGCACTACGGTCACCCCGATATCTTCGACAAGCTCTTTGCCATGAGTTGTGGTGGTACTGCCAAGGCTTCCAA
GGGTGTGAACCTTTCGGAAGATATTTTTGCTGGTTTTAACTCTACTCTACGCGGTGGCCGTACTTCTCACGAGGAGTTCATCCAGGTCGGCAAGGGTCGC
GATGTTGGTATGCAGCAGTTGGCTCTGTTCGAGGCGAAGCTGTCGTCGGGTGCTGGTGAAGCAGTTATTTCCCGTGATGCGATGCGTATGGCATCTCGTC
TGGATTTCTTCCGTCTTAACTCGTGGTTCTACGGTAACTTGGGTTGGTACTTCACGCAGACGATGACGGTGGTGGGTGTGTACTTCTTCATCTACGGCAA
GGTGTACATGGCTCTGAGTGGCATGGACAGCTACTTCCTTGAGAAGGGTGGACTGGGTATTGCCGGTACGCTTAATACGTCATGGGCGTTCCAGTTCGGT
TTCTTGTTGGTGGTGCCTGTTATTGCCGTTGTTGGTGTGGAGCAGGGTTTCCGTCATGGTTTTACCTATTTGCTGTGGAACATCATGACTCTTGGTCCGA
TCTTCTTCACGTTCCAGATGGGTACGCGTATGCACTACTTCGACCGCACGCTGATTCACGGTGGTGCTAAGTACCGTGCGACGGGTCGTGGTTTCACGAT
CAAACACGAGAAGTTTGCGGAGCTCTACCGCTTCTACGCATTCAGCCAC