Description :
From Genome Similarity Track
Location :
Scaffold_85:279738- 282045
Sequence
2307 bases(100 bases per row)
TGGACGATGATAGAAGACTTAGCCGATGCAAACCACGAAGTTTTTTACGTAGCGTGAAATATGGAAGTGCATGCAGCCATGAAAAGGACAGAAGGACAAG
AATATGACGGGAGCGTACGGGCCACAGAAGGGAACTAACTGCATAGACACCCCAGCTTGCTGAAAAGCACGGGCTACGAAAGAGCACGTACGCTCGAAGC
CACGGTAGAACACGTAACGGTAAGAGTGCACGGACAGAAATATCTCCCATAGCACCACGGCTGAACACGGAGCACAGTAGACCGACCAAACATGAAGCCG
CGGAAGACCATTAACGGGAGGTTGTCGAGTATTGAAACACGATACTAGAGTAGAACCGGAGCTCACTGGGGAGCGCGATACTACTGTAGATAACGAAAGC
ATGGGCGACAGACCAGCCACGACACCAAGAGATAACACGATAGCATGGACGATGGGACAGCCACTAAAACATGGGAGAACAAACAGCCACGGGAGATCAC
CGAGCCACTGAGCACGGTAGCACTGTAGAACCTGATATCGCCGGGCCACTGAGGACGATACTTCATTAAAACACGTTTACCCGGACGGCCGACCAGCCAC
AAAATCGCGGGGAAACGCTTCTGGAGACCACGATTGCACACTGCGAAACACGGAACCATCGTAGAGCGCGATAACATTGGCAAAACATATATACTATGCG
ATCACGATAGCATAGACAGCATAACCACATTGTTAATGCACGATAGCGTGATAACGCGGTAGATGGAGCCACCACAGGGGTGCGCGGCACACAGGTGACA
GAAAACTTCGGAAGATCACCCATTGGCGAGGGTATCGGAAATGGAACGCTATCGACTATGAATGATTATGGACACGAAGCCTGTGGAATCCACGTAAACC
CTTGAGAACACGGAATATCTAGCAGCCACGAAAGAGGGTCGTACTACGGGAGCGCATGAGACCAAAGGAGCTAGCACACAGCCACTAAGCACTGTGAGAG
AATGAGTTCACAAATCCAGCACGGGTGAGCAGGGAACCACGAAGCCCGAAAGATCACGGAAGAGCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTTCCGACTTCGCG
AACAGCCCTGATGCGCTTCTACACTTTCGAAAACCGACTTTCATGCGGTCATTCCGGGCCTACAACAACGTATTCGCTTTTACGTCCATGGGAGCTTCGC
GGTCTGGGCCTCTTAATGTTGACGAAAGCGTGACACGAAATGGTGGCTACTACTTCCGTGTACCAGGGTCAGTGTGCCACCGCATGGGATCGTTACTACC
TCCTACC