Description :
From Genome Similarity Track
Location :
Scaffold_12:27973- 31639
Transcript NameFunction/comments
Physo_108492catalytic
Physo_130578predicted protein
Physo_130579AGAP006394-PA

Sequence
3666 bases(100 bases per row)
CGCCGTTCGAGGCCTGGATCAGAATGTCACGGGGGTGGGCAAGGTTCGAAGGGTACTCGAGCTTCTCGTCCTCCCACGGAAGCTTGTATCCCTCGAGGTT
CAGGTTGCCCACCGAGTAGGCGCTGACACCAGCAACGACGTTGGCACCACGACCGGTAGCCTGGACATCACGGATACGGCCACCCGTGCCGGTCTCAGCA
CCAGGGAACGGCGCCACGCCCGACGGGAAGTTGTGGGTCTCAGCGGTTAGCAGCAGGTGGCTGTCAAGGGTGCGCTCCTGCACGGCCGAGGGCTCACCGG
GGTTCACGGGGCCGAGCGTGACAATGTTGGCGCCCTGGATGACGGACGAGTTATCGTGGAAGGCGATGACACTGTTCTTCTTGGCGTTCTCGGTGAGCGT
GTCCTTGACCATCTTGAAGAGCGTCGTGGGCATCTCCTTGCCGTCGATGACGATCTTGCCGCCGAAGAACCAGTGGCGCGAGTGCTCCGAGTTACTCTGA
CCCATGTCAAAGCACTCGACGTCCGTGGGGTTGCGACGCAGCTTCTCCTTGAACAGGTTCAGGTAGTACTGCAGGTCCCAGTCGTCGAAGCCGAGGCCGA
TCTCCTCGTTGATCTCCTTGAGCGCGTCGATGCCGCGCTCCATGATGGGGATCTTGCGCACGAGCTGCACCGTCTTGCCGTGCCAGAAGCTGGCCAGCGG
CTTGTCGTACACCTGCTGCGTCATGCGGTCGCACTCGTGGCGGAGCAGCGCCTGCTTGAGCGTGTTCAGGGCCTCGGGCGTGGTGGCCGTGTAGCGCACC
AGGTAGCGCGTGGCGCGCTCAATGCGCTTGATGGCGGAGATGCCGCAGGCCTGGCAGATGGCCACGGCGTTGCTGGACCAGGCCGTGGAGAAGTTCATGC
GCGGGCCGACCTCCACGAGCCACTCCTTGCTCTGCTCGGCGGCGGCCAGGAACGGCTCGTCCGCGCGCGTCTGCTGCGGCTCGAAGGTCTCGCTGAGCAG
CCAGTGGAGCGTGTCCTGGTCGGCGGTGGACAGCGGGCCGGACCCGGCCGTGGTCTCCACGTAGAAGCAGTACTCGGTCACGAGCTCGTCCACCTGCAGG
CCGGCGTCGGCGCCCACCTGCGCGCGCAGGTAGGCCAGCAGCGTGCGGTTGGCGTGCGCCGTGAAGGCCGGCGTGCGGTAGAAGCGCAGCAGCGCGCTGG
CGTGCGCGCTGGCGGCGGCCGTCTTCTGCTTCTTCTCGGGCGACGAGGCCATGGTCGGAGGAGGTTGAAGCTCGGGGAGGAGCTGGCGGAGGGTGGGGCG
GACACTGCAAAAGCGGTTGTGTCTGCGTGTTGGGCCGTGCCTCTTGCCTCGCCCCTGGGGCCAGTGGTTAGATATGGATACAAGCAGAACGCATTCTGAT
TGGCTGAAATGAGATTTTGGACCAATCACACGCGACTAAGGACCGAAGCCCTACATAGACCCTGACACCGCGGAGCAATGCTTGGACAGCAGAGCCTCCC
ATCGCGCGGATTAACGATTTGCACCGGAAGCGCGCGCGCGAAAGCTACCGCGGCCAGCATCCCAGCATTTGTGACCAAGACGACCAGCGGTCGGCCAACC
GTCGGTCGTCTAGAAGTAAAAATTATTGAAGGAATCGAGCTGCAAGTTCCTAGGTTTAATTGATCTGGTGACCCGGACATCCTGCGCATCCGCGTGTGCC
ACATCCGCATCGGCGGACAAGCTCCTTCCCATACTCCGACACGGTAAAACGAGTGGCCAGCCCAAGGTCGCTGCTGACGTACCTATGGTACAGTGTACCT
TCGTCATTTCTACCAATCCATTCTCTGTAATTCTACCCAATCACAAAATATACCTTTTTCTATCCAATCGCACCCATCAAAAGTTCGAGCCAATCCTGTC
GCTGCACGGTCTCCGCCGCACAAAAGGCAACACCAAGATGCTGCAACGTGGGGTGGTGCGTCTCGGACGCGGCGTGCGCGCGTCCGCGGCCCTCTCGCGT
CCTTCGGCGTCCAAGAACTTCGCATCTACCAGCGCGCGCTTCAGCTCGTCGCGCCTGCGGTCGGTGGCCCCCATTGCTTCCTCTCCGCTGCTGCAGCGCG
CTGGTCTCGTGGCCGCCGCCAGCACCAGCGCCGCCTGCGCCTTCTGCTCTGCGCCCGCCGTGGATGCCGCGGCCGTAGCGAAAGAGGGCGGCAATGCTCT
GCCCAACGTCGTTCTCTACCAGTACGAGCCGTGCCCGTACTGCTGCAAGGTGAAGGCCGTGCTGGACTACCTGAATATCCCGTATGAGGTGGTGGAAGTG
AACCCCCTCACCAAGAAGGAGACCAAGGCCTTCACGGACTACCGCAAGGTGCCGGTGGTCCGCATCGACGACGAGGTTGTGGTGGACTCCTCCGCTATCA
TCTCGCGTCTGCGTGAGCTTGTCCCTACCCCCGAGGGCTCGCACCAGCAAGATGAGGACGCCCTCGAGGAGGAGGAGAAGTGGCGCCAATGGGTCGACAA
GAAGCTCATCCTCCTGACGCCGCCTAACATTTACCGCACTGTACCGGAGGCGCTGCAGGCGTTTGACTACTGTCTGACGGAGGGCAAGTTCACGCCCATG
GAGCGCCGCATGTCCAAGTACGCCGGTGCTGTGATCATGTACCTGATCGCCAAGCGCTCCAAGAAGAAATACGGCATTGACGACGAGCGCCAAGCGCTGT
ACTCGGCGCTGGATAGCTGGGTGGACGCTATCGGCGACAAGCGCGCGTTCCTTGGAGGTGACGAGCCCAACATGGCTGACCTGTCGGTCTTCGGCGTGCT
CCGCGCCATGCACGGACTGGACACGTACAACGACATGATGCGTGAAACGAACATCGAGCCTTGGTTCACGCGCATGACTGCTAAGGTCGGCCCCAGCTCG
CGCACGGCTAGCAACTAGACAATACTGCTTCAGCGCAGCAAAAAGACGGGTAGCATCAAGCTAAACAAACGTTCAATTATCGTACGCTCGCATTTCTATA
TAAAAGCCACTTGGTGGCCTAGTTGGTGGCATCGCCCTTCTTCTGAATGCGGTGGTAAGCCACACCCGTGCCAGAAATGTTGTCTCCGAGTCCAGCAGTG
TGGTCGGGTTTCTTGCAGGCCATCATCGGTACGAGATGGCACTGGAAGTTGGCCTCCTGCCACGTGACGACGGGCGAGAACGGATCCAGATCCACCTTGA
GGCCCTGACTCTTGCTCAGAAGCTGCTGACGAGCCAGCAGCACTTCAATGCGCTCCGGGTCCACTTCCATTTCAGCGCTGGTGCGCATGGGCTTAGGCTT
ATCGTCGTCAGCAGCAGTCTCACTGCCGGGGGCCGGCCTCTTGCCGCATGCAACCTTGGAGCTCATGAGAGCGCTCTGCACCAACGCCGTCGTCGGATCC
TCCCACATGCTTCCTTCCCTCTGGCACACAATGTGGAACTGCAGCGTGTGGAAGTGGATGCGGGAAAGCTGCGCAAGGGCGTAGCTGTCCTGGTTGTCAC
TGTCCTCGCTGTTGTCCTGGCCAGAAGTCTGAAAGCTCTTCTTAGCTTTGGACGCGAACTGGATGACGTCGTGCAGCTGAGCGCTAATCTCCGCCACCGT
AGGACGCGACGTCGTAGCCGTGCCCTCTTCACCTGTGACGAGGTAGTGGTGCAGGATAAAGAGCTC