Description :
From Genome Similarity Track
Location :
Scaffold_12:27973- 29072
Transcript NameFunction/comments
Physo_108492catalytic

Sequence
1099 bases(100 bases per row)
CGCCGTTCGAGGCCTGGATCAGAATGTCACGGGGGTGGGCAAGGTTCGAAGGGTACTCGAGCTTCTCGTCCTCCCACGGAAGCTTGTATCCCTCGAGGTT
CAGGTTGCCCACCGAGTAGGCGCTGACACCAGCAACGACGTTGGCACCACGACCGGTAGCCTGGACATCACGGATACGGCCACCCGTGCCGGTCTCAGCA
CCAGGGAACGGCGCCACGCCCGACGGGAAGTTGTGGGTCTCAGCGGTTAGCAGCAGGTGGCTGTCAAGGGTGCGCTCCTGCACGGCCGAGGGCTCACCGG
GGTTCACGGGGCCGAGCGTGACAATGTTGGCGCCCTGGATGACGGACGAGTTATCGTGGAAGGCGATGACACTGTTCTTCTTGGCGTTCTCGGTGAGCGT
GTCCTTGACCATCTTGAAGAGCGTCGTGGGCATCTCCTTGCCGTCGATGACGATCTTGCCGCCGAAGAACCAGTGGCGCGAGTGCTCCGAGTTACTCTGA
CCCATGTCAAAGCACTCGACGTCCGTGGGGTTGCGACGCAGCTTCTCCTTGAACAGGTTCAGGTAGTACTGCAGGTCCCAGTCGTCGAAGCCGAGGCCGA
TCTCCTCGTTGATCTCCTTGAGCGCGTCGATGCCGCGCTCCATGATGGGGATCTTGCGCACGAGCTGCACCGTCTTGCCGTGCCAGAAGCTGGCCAGCGG
CTTGTCGTACACCTGCTGCGTCATGCGGTCGCACTCGTGGCGGAGCAGCGCCTGCTTGAGCGTGTTCAGGGCCTCGGGCGTGGTGGCCGTGTAGCGCACC
AGGTAGCGCGTGGCGCGCTCAATGCGCTTGATGGCGGAGATGCCGCAGGCCTGGCAGATGGCCACGGCGTTGCTGGACCAGGCCGTGGAGAAGTTCATGC
GCGGGCCGACCTCCACGAGCCACTCCTTGCTCTGCTCGGCGGCGGCCAGGAACGGCTCGTCCGCGCGCGTCTGCTGCGGCTCGAAGGTCTCGCTGAGCAG
CCAGTGGAGCGTGTCCTGGTCGGCGGTGGACAGCGGGCCGGACCCGGCCGTGGTCTCCACGTAGAAGCAGTACTCGGTCACGAGCTCGTCCACCTGCAG