Description :
From Genome Similarity Track
Location :
Scaffold_1754:2797- 3872
Transcript NameFunction/comments
Phyra_87272PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1075 bases(100 bases per row)
TCGACGAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCAGTGATCGACTGGACGAAGCG
CACGATCGTGCACTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGACCCTCCACTAGAG
ACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAAACGAATCAGCAGGGCCTGATTC
GATCGGATTCGAGAGGGTCTCGATAGATATTGTCGACACACAATTTGTCGAAAGACACTCCGCCGTTAGGCGTAGATGTAAAGAAGGTGCGTCGGCTCTG
GGAGCCGACGCTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACG
CGTGCGTCCGCGGGTAGAACCCGCCGGCGAATACAGGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGA
AGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCG
TCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGAGAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCT
CCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCGGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAATCA
GAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAACAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGA
GCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGATATTCCTGCGGAGTTACCGCAGGACA