Description :
From Genome Similarity Track
Location :
Scaffold_1839:2797- 3808
Transcript NameFunction/comments

Sequence
1011 bases(100 bases per row)
CGCCCATAGCGCGTACGCCGCCCTGATCGCACATCCACAATCTTGTCAACCTCGTATTCGTCTTCGCCAAGGCTGCGTTCCCAACTATCTTCTGGCAGGA
TTGCTTCGTCAAAATCGAAACGATCGCCTTCAACCACGGTAAGTGCCAACGTAGGGCGATCGGGGAAACTTCGCACCAGCTTGAGCTTAGACACGTGGAC
GATCGGAAATAAGCGGTACTCCGTGCCAGCAGTCTCCAGTCTCGCTGCGTGATTACCTATCATCTCGACTACCCGGAACGGGCCGTGCCACATATGCGCC
AGTTTTCTCGCGTAGCCTTCCTTCACCCGGTCCAGATACAGCCAGACTTGTGCACCAGCCTCAATCTCCTGGGATCGGACGTTCTGGTTGTGCTCGTCGG
CTCGCGACTGGATCGCTTCCCGGAGCCGCTCATTTACCTGCTCCCTTGCGCGTCGATATTGACTTTGCATGTGGAATCGCCATCGTCTTGGCTCGCGATC
ACGTCGGCGCGTGCTCCCGACGGGTAGCGCCGCTTCCAACGTGGATCGTGGGTCCCATCCGTGGATCAGATAGAACGGTGTGTCTCCACGCACACGATCG
TGGGCCGTGTTGATTGCGAATGTGAGGCGTTCTGCGTACTCGTCCCAGTCCTGTTGGTTAACGTCTGCGACGTACATCTTCAACGCTCGAGTCAACGTCT
GCACCATACGCTCGGCTGTTCCGTTTGCCTGGGGCCGGTACGCCATCGTGGCTCTCTGTTTTTGTCCCACGATCCGGCTGAATGCACGGAAGAAATCAGA
CATAAAACCGGGTTCTCTGTCGTGCCGGATGGCTTCACTGGCTCCAAAACGGCGGAATACACACTCTTCATAATTCTCCGCGATCGTCTGGGCCGTCCTT
GACGCACTTGCTTTCGCGATCACATATCCCGAGAACAGGTCTACCCAGATCAGCAGCTCCGTGTTGCCCTTGAAGGACTTGGGCAGCGACGGAATGTGAT
CCATCGCGACA