Description :
From Genome Similarity Track
Location :
Scaffold_12:279673- 283226
Sequence
3553 bases(100 bases per row)
ACTTATATCTAGAGCACAGTATTGGTAAAGCCCTACGCACTCGTTGTTAGTGTCTATTGTCCGCTTTCGAAGACTTCATGACATTTGGGGTACCCTAGAG
TCTACCGGCACCCTAAAACTTATTCGACGATGATGTTGCTACTTCTACGGGTTCAGTAGCCGCTTTGTATGCGGTTCGTCGAACCACTCAGCCCTATTTC
TGTCAGCTCATCGGATGGAGTGATATTATACTACATCAGCCTTTCTTGCAACATCTAATAACGACCTGCAAATCCCTGTTAAGCTTTGTGGCTGCTATAT
GTTTCTTCCACCATAAATGGGAGATACTGATTTCGACAATCGAGTTCTGTACATTTTTTATTTCTAGCAGGTCCGGTATAGTCTAACGAAATGCCAACAA
CGCGTTCATAACACTATTGTCGTCGTATACAGAGCATGTGCTGAGCAGTGTTTCTCGAACTAGCTCTATTCGTGCCGTAGACTTACAACAGAGTTACCAG
TGGTCATTTAGGGAGAAACAGAATTAATCCAGACAGTGTACGTACTGAGGGGATCGACGAATGCCGTCCTCGGCAAGAGAATAGGATCCACTATGGCTAA
TGGACAAGGTTTCACGCGTGTTTTCTCGTTTCTTCTCGTAGTTATGGAACAAAGAGACTTTTCTGCATCACGTCATCCCCATAGTTGCGCTCGTCGACTG
CCTGCTCTCTGTCTTCCGCGTCGGTCAGTTTTCTCCTTGTATTACCGGGGACCGTACAATTAAAAGTGCGTTACATGTATGTACCGTGTATCATGAGTGT
CAGCGATTCTGTAGACGAGAGCGCTAGTGGAAGTGGAAGCCGTACCTGAGGCTTAACCAAACTGGCGGGATATCCAGAGGTGGACAATAAGCACTGGTTG
TCAAGGGAACCGAAAAGTTGAGATTGGACCGAGCTAATTTCGATGAAGGCTACTTTGGTCGGTCTTACCGTCCTATGTAATCGTAGCGCCTGCGGACTAA
AGTTCAAAGCCCTTGGCCCATTTTAAAACTATACAAATTTGATGTTGGTCGTCCAGAATGTTATCATCGATGTCGACTTCGAGCATCGAGCTTGCACTAT
TAATTGGTGACTTGCTTTCTACTACAGCGGTCAGGCCAACAAAACCGTCATGAAGTGTACAACGCTCCAAAATTCCAACAACAACAAAAAAGTCGATCTG
GAGGCTTTGTATTGTAATACTACAGGTACTCTTGTGATCGTCTTAGAATGTTAGGCATTGAGGCTTAAAAGGACCTTACAGCTTCGCTAACGACGCGACT
CCATGGTCTCGAGAGCAAACGAACGCTCAAGGTAAGATGTTATTAATATCAAAGCACTCCACTCCAGCTACGTCAGAGCAGATGGGAGCTGTGTAAATAG
AGTCGCATGGTATATTCAGGTCGAGGTAAGGATCAAATCACACTTGCTGTGGTAAGTAAAAGGAGCTTATCAAAAAGGCCCAAACAAAGTAAAACAATGC
GACTACATGGCAAATAATGCGAAGTCGTAAAACCTACCGACGAGAGCTAGCTCGCTTCCACGCTGACAAAGCAGCCGAGTAAGAGTCTAAGCACGTTTAC
GCGCTGCTGAAATGTGCTTGCGCGATGGTACATTTCCCTCCTTGTATAGTCGTCAGCTCGTAAACGTTCCCCATCCTGTCGCAAGTTCCCGACTCCACGT
ATGGCGCTCTTGCCTTCGCAAGGTCATTTTACGTTTTGCCAAGCCAAAACTCAACACAGCACAACTCAACATACACCAAGCCGCGGATCCAGCAGCAACG
ATGAACGTCATATGAGCTTCTTCGTCTTCGTCGCTGCCGTCATCTCCGGGTCTACCTTCGGATCACCCTTCGCTTGCGACACTCTACCGATATCCGCGGG
TGTCAGCTCCAATTACGTTGTCGAATTCAAAAAGCATGCGCGAACGCTTTTTATAAATTACCAAGCGACAGCAAAATAAGCAGCGCCTGCTGCGATCAAA
TGTGCGCTGCCGCAAAAGGCCGACTGTGTGCTAAAAAATGAGAAGCACCCCATCCAGCTGACGTGGGCATGAGCTTCTAGTCTATCGTTCGATGCTGGGC
GAGCCTACTGGCAGCTCTTTGACGGTAGCACTCGACGATGATTCAGTCTAATGCAAACAAGTTGTCATTGCTCACTGAGCTCTCTCGTGTTTCGTTATGT
TTACTGGTTTGCGCATTGCTTGTGATGGTAGTAAGTGCTTCGTTTAAGGAAAGTAGCGACTGCCAGCAACCAAAGCACGAGACAAGGATAGGAAATATCT
ATTGGAAGTGTATGACGTAGTAATCACTTTGCTCCAAAGCTTGTTCGACACTCTCTCATGTTCAGCGGATTCGGCGCATGAACCGACTCGAAAAGGTTCG
GACCCCGTTGATGCCCGAACGATTGCTGGACGTTGTACTATCGCACCCTCTTTAGCCTCAGCTATGTTGCCACTATGTACGCAATCACGACACAACGTGA
CAGTGACGTGAGGCAAGCATCCCTTTTATTCACGGTCACTGCCCATCTTGGCTGTAGTGCTACGTGCTCAAAAATTTCATGGTGAGGTTCGCCACGACAT
CGTTTGACGACGGACCTATTGGCACTTGGAAAGTGCCGATTGCGTTGCGCAATCTGCGGCGATACTGGGTTGACAAGCAGTGGTGGCTCTCTAGCTGCGT
CTTTCCAGTCGGTAGTCACCGATTATACAGCAAAAACCATGTTTACATCTCCTACCAAGCTGGAAGAGCTTGAACAGTCGTCGATTGGGTCGATATCCTG
AAACTGGATCTATTGACAACTCATAAAGTCATGTGGGTATCGTTCCAAGACCTCGATCGACGTTATCGGTACCGTCATCGTTCAGTTGATACATCTGTCA
TCAAATTGTTGCCAGGTCCGTAACTCGTGACGCCGTGGTCCTCCATGATGGTGATTCATGAGAGTGAAGGCATCTTTTTCCCTCTTATCCAGTTTTTCGG
CACATCGACGACTATTACTTCGGGAACAGACTGTCTGTCTATCTTGACGGTTGACGAGATTTCTGAAATGTCCTTACCCACGTAGTGCTTAAGGAGATGG
CTTCTGTAGTCTTAGTCGGGTAGATACCGCGGCTTAACATTCGCTGAACCTGTACTGTCCAGGAAGAGATAAAGATGGCCTGCATCCTGCGGCGTGAATC
GCGAATGACTCATGCATATCCTCTGGGACTGCACGTGAGTAAACAAGCGCGGGGGTATATATATCAAATATCTCTATGGACAAGATTCAAAGCAAAGCCG
CTCAAATATGCTGCTTTACAAAAGAAAGCAGCGTTATCCCGATCGCCGCCGGGGCTACCGTCCTGGGTGTGAGCATGTTCTCTGGCACCGCTGGCAGCGT
GGGACAAGCCTGGAAATTGATTTGGTGAATAGTTCGCTCCATCTGCGATATGGATCGATCGGCTCAAGAGAATACATAAGTAGCAATTTGCATACACTGA
CAATGAGGTAACGCAAATGCGACAAGTTCTCTGTCGAGAACTATGGGCGGTCA