Description :
From Genome Similarity Track
Location :
Scaffold_21:279632- 282111
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008207Protein of unknown function

Sequence
2479 bases(100 bases per row)
CGCGATCGTGTCGTCTCCAGCTTGCGGGGCGCATAGTTCGCGACGTCTGATGATGTATGGCGCGTATACGACACTTGTGTGTCGCGCGGATTGCCCTCTT
GCGCGTCCATTGGACCAGGCGCTCGTAGCAGGTATGATGATGATAGTGAGGTATATTATGTTACGAAGAACGAACTAGAATATCCATTCTCCCAGTTACG
CCACTATAGTGGTTTCAGCGGGGAGTGATGTCAAGGTGGAGACGTCTTCAGCGTCTTCACCACGACCTTTACAAATATTGACGCATAAGGTGTCCCATGG
AGACAGCCAAATCGTTACGAGAGACTGGGTCGTTGCCATCTTCGCGTAAGCGATGGTCGAACCAGTGCTGGACGTCGCCTTCCATTCGTTCGTTGAGTTC
TGCTCCCGTGCGTCGTGAGGTCGGGAAAGCGTACTGCGTCGATGTCGAAGAGTCCATAGCGTGGTTGGCCGCAAGGTCGGCCATTTTGTTGTATGCTCGA
TAGTAATGTGTCCAACTGGAGATCGCCATTATGTCAGCAAGGCGTTTGGATTGGAAATATAGTGCTGCCAGCCTCCTGTTGTTTGGTGAGTGATGTCCCA
GCTGCTGCCTAATGATCATTGCGCTGTCCCCTACTATGTGTAAAGGTTCGCAACTCGCTCGTAGCAGGTACGCGTCTTGCACAGCACGGCATCGACGTTC
CAAAAGTGATTTTGGTTGAGCTCGTACATCTCGACGTTCGGCATGAGATACACGGATTTATCTTTTGGAAAATGTGGGGTGTCTAGGACTCCGTCCCAGT
AGTGGTTGAAAAGCACGATCGGTGTCTTTGGGCACAGTTCGTGGTACGTGACCGTGCGATTGAGTGTTGCGTCGGAAAGTGGGATCTCGAGTGCCCAATA
AGGCAACAATCGTGACTTCAGGACTGCGTCACAAAAAAACAACAAATGCCAGCGCCCGTCAAACGCATTATGGAAATGCCGTCCACGCACATTTCGCGTA
CCCGACAGCGTCTTCGCAGTATCCAAAGCCTCGGATCCCTGAAGGAATGAAAATGTCGACATCAAGGCATTGGCGAAGCTTGTCAAGCAAGTTTGGATGC
TCTGGCGTGAACAGCAGTTGTAGGTTCTTGTTGTCGTTCTGTTGGTCGGGTCCAGGTTTACTGTACGTTCACGACACGATTCGATCGCGATGTGCAACGT
ATGCTGCATGCAAGAGGCTCAAGTGCATTCGCTCGTCCGTGGGGACTTCATCAGTCTCGTTGTTCTCATGCATCCACGACTGCAACTCGCTGCTGTTCTG
TGCCAAAAGGGAATCAGCGTACTCTTGGAACGCGCGCGCGTGGTTCATGGCGTTCGCGTGGGCAACTCGAAACCGGCGCATGTCGACGAGCGACCAGGCC
TCGAGCAGCAGCATGACCACGACCTGGCCCAGCAGCAGCGACCTCGCGAGAGCGAGGCGACGCGTGCGCCACCACGGAGGTGTCGCAGGCGCCATTCCGT
TCCCTTCTTCCTATCGTCGCTCTCGAGTGAACTGAAGCGTAGAGCTCCTCGGCCGTCAGGAGCTCCGGTTGCATGCAGGGGGAGACTGTGGTACATTGTA
GGAGCATCCTGGCTCGTCTCTGCGCGCACGTGTGTCCAATTTGATGGTACAGGACTGAAGGCAGTCGGCACAGAGACGAGGCGAATTGTATCACAGTTGG
TGTCTTGTAAAGAGGGGATCTTGAAAAGAGGGACTGCTGTACCAGTGAGGACCTGGGCTATTTATTGGCCCTCCTTCTTTACACGGCCAACGATCCCCAA
TGGACCAAAGTCGTTTGCCTGCGTATTGCTTTTTTCCTGTGTCTTCTGAGCGTCCTAGCGTTATCTGCTTCTCGTCCCGCAGGGTTTCAGTGCTGGACGA
CACTGCTATTTTGAAATTGTGGACTCTAGGACTCCGTACAAACTGTCACTCCACGACCTATATTCTGCAACAGACGCTAACTCGCTGCTTCTGAGCAAGG
ATGGAAAGCAACAACCTCTAGCGCATTCAAAACAGCTTGCGCCCACACTACGCGCATTCGTCATTTTCACCCGTTCGCAACAGGCCAGTGATTACTACAT
AACGCCAGCAACGCCAAGGTGAAGCGAAAATCTACTGCTGTGAGTGGACCGCGGCGCATGCATTCTATGGTCTTCATTTTTGAGTAAGGTATATTATGTT
ACGCGTGGCGAACGACAATATTCTATGGTCTTCATGGCGCTGCTCGCCTTCAAATCTTTCGCGCTCGTCTTTGAAGCCGCTTCGCTGGCTAACATACACA
CTGGACTCCAGCTTTCCGTCCAGACAACAGCCAAGCATGAAGTGAACTTGGACGCATTTCAGGAGCATCTCACCTTGGGAGGCAGCGTCGAGGACTTCAA
GCCATGGATGCGTGCAGACAACGACAGTAAAGTGCCTTCGGACGAGCGTCTGAACTTGATTTTGCTTCAAACGGCGTGT