Description :
From Genome Similarity Track
Location :
Scaffold_1:2795703- 2798162
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00728hypothetical protein
Phypa_INRA-310PPTG_00729hypothetical protein

Sequence
2459 bases(100 bases per row)
AGCATGTCGACCAAGACTCTGCAGGGAGATCCGCGCCGCCCCGGTGATCTGCACCCTTTTGTGCGCGAGCAGGTGGATCCGGATGACGCCCCCGGCGACT
GGTACGCCTTCTTTTCGCTCGTGCTGGGCTTCCTGGCCTTCACGATGAAGGTGCGTTATCCCTCCCCTTCTCGGGAGTTCCTTCTTGGTTTACTGAATGG
GCGCCTATTCAGTTGACACGAAACGCTAATGGTTTGTGTGTATACTTAGTGGAAGGAGCTGGCGTGGGGTTCGCTGCTGCTTTGCTTTGGCTCGTTAACC
AACATGAAGTCTCAAGATATGAACACGACGCAAGTGGCCATGTCCTTCTTCTTCTCCACATCGGCCCTCGTGTCCGCTTACATGGGTACCATGCGTCCAG
GCATGCCCATGCCATCGGGCCAAACAGTGGAAGCCCCCGCTTCGTAGAGTCAAGGGAAGACAAGAATCGAGTTTATCTAGCAGAGAAACTTCGCTGCTGT
AAAAATGAAGCTGTTGGTACTGTGCTGTTAGACGTGGTTTGATATTGTTGTCACACATTCTGGAAGTAACGACTAAAATGATGGGGGTTATTTAGAATAG
AAACGCTGATTGCAACAATTTGTACTGGACAATGACCATCAGCCCCCATGAAGCGTACTCGGAGAGTTTTGGAGAGGAAGCAGCTCGCACGAAAGCGACG
CTACGCGGGGGCTACCAGAATGCCAATCATGACGCTGCTGGCGCATTACCGCAAAAGTTGATGAAGCGGCCGCGAGGGCCTCCACCAGCGAAGATACTTG
CAGCGTCGACTACACCGAGGACACGAATCTTGCCACCTATTAGGGCAGCAAGTCCCAATACACCTGTTGCGTCTTCTAACATGACGCTGGAAGAAAAACA
ACAACGACAACTGCATTCGTTCCTGCGCAACTTTCTCGCGATGGGTGAAAGCGGACGCTTCCAGCAGGTGATTGATCTGCGCCAGCATGGGATTGACACA
GGAATTACAGTCACTGACGCAACGTTACAAGAAGTTGTGCTCACAGTGCCGAATCTACGTGGACTTAATCTCTCCGGCTGCTCTCATATCACGGATGCCG
GGCTTTGGGCTGTAGCCAGACACTGTCAGACACAACTCGACACTATTTATCTAGCTCAGTGCGAGAAGGTGACAGAGCTTGGGTTGCGTCTCCTCGCTCA
TAATTGCAGGCTTGTACTGGTAGATCTGAGTGACTGCCCACAACTCAATGACGCTGCACTACAGACGCTCGCTGCGGGGTGCTGGATGATCGAGACTTTC
ATAATGAAACGATGCCGAGGAGTCTCGGACGCTGGTATCGTCAAAATCGCTCAGTGCTGCAAAGATTTACGCCATCTGGATGTCTCCGAGTGCTCTCGAC
TCGGTGAATACGGCGATAAAGCGCTGCTTGAGATCGGGAAATGCTGTCCGAAGTTACGTGTGCTGGATCTATTTGGCTGTCAGCACGTGCATGATCCAGG
TGTCCGTGCTGTCGCGAAAGGCTGCCCATTGTTGACCACGCTCAGACTTACGGGGTGTCGAGATGTCAGTAGTAGCGCTATTCGCGCATTGGCCCAACAG
TGCACCCAGCTTGAAGTGTTATCACTTGCTGGATGCATCAAGACGACGAATAGTGATCTCGAACTGCTGGCAACCAACTGTCCGCAACTTACGTGGCTTG
ACATCAGCGGCAGCCCAAATATCGACGCGCGTGGTGTGCGTGCACTAGCCCAGAACTGTACTTCCCTTACGTATTTGAGCTTAGCCGGATGCCAACGAGT
GGGTGACACTGCATTGAGTGAGCTTACCAGTGCAGGAGCTGGAGGACTTGCGAAGTCTCTTGGGGAGTTATCTCTCGCAGATTGTCCTCGAATCACGGAA
AATGGAGTTGATGCCTTAACTGCCGTGTGCTCTAACCTTATCACGCTAAACCTCACGAACTGCAAGCAGGTCGGTAGAAGGTTCCTACAGAGACTCATAA
CAAAGCTCGAGTTCGTGCAATGGGCCACCAGTTTCTTCGGGTTCGAGCCACTACCCAATGCCGCCGAGCTTTGTCGCCAGCGCGATCTCCGCTTACTACA
ACTACAAAGTGCCATTAAAATCCAAGCAGCGATGCGCGGGTGTCTTGCTCGAGGTGGACTGTGGCAGGCAAAACTCAAGTTCGTGGAACGAAAGATATTA
CCGAAGATCCAGGCGCGCATACGTGGGTTTTTGGTGCGAAAACGTATTGCAACAGATAAGAAATATCAGCTAGAAGATCGTGCTGCATGGTTAATTGGGC
GTGCCTATCGTGACTTGCAACTTCGACGGATGCTAAAACACGCCAAGAGGATTCGTCAAATTAGGGAGCACGAAGATGAAGCTGCTCTTATTTTCCAGAA
GAACTTCCGCGGTTATCGTGATCGCAAGCTCGTATCGAAGATGCGACACGATATCTACT