Description :
From Genome Similarity Track
Location :
scaffold_150:27953- 30766
Transcript NameFunction/comments
g4653.t1hypothetical protein

Sequence
2813 bases(100 bases per row)
AACTTCCTCCCGAAGAATTTGTTCAAGCAATTCACCCGCTTCTCCAATGTCTACTTCCTCGCCATCACAGTGTTGCAACTCTTACCACAAGTGACGTCCT
CGAACGGAGTTCCGACCATGGTCGTTCCCTTGCTGTTTATTATCGTCGTCAGTGGGGTACGAGACATCATGGAAGACGTGCAACGGCATCGAGCAGATAC
CGAGCAGAACCGAGCGCCAGTACGGATGTTCGCTTTCGTCGATGGAAAGGCAGGAGATTTTAACCCCACAACATGTCAAGAACTGAAAGTGGGCGAGTTA
GTTCGGATCGGAGAGAACGAAGAGGTCCCTGCCGATATCGTTCTGGTGGCTTCTGGTTCTCCTAATGGCCAATGCTACGTTATGACGGCCAATCTAGACG
GTGAATCCTCGCTCAAGCCTAGGTTTGTACAGCCAGAGCTATGTCGACCTCCCTATCGAGACTGTTTCTCGCATGATGGCCAGCGCGTGACATCTCAAGC
CACAAATCTACTGCCTAGCGTTCGTATCGAGTGCGAACCGCCCAACCGATGTATTGATAAGTTTAAAGGAACGCTGGTACTGGCGGAAACTCGATCAACG
AGTCTGGATATCTCGAGCGTCCTGCTACGTGGGACCCACTTGAAAGACACACCTTGGGTCATTGGGGTGGTCATTTACACTGGAGACGATACGCGAGTGC
GCCAAAATGCATCAGAGACTCCCATCAAGGCGAGTTGGCTTAGCCACTTTATCAACCAGATCACCGTTTGGGTCGTGGTTGTTCAGATTCTAATTCTAAT
TGTCGCGGTCGTGGTTGAAGCGCAATTGGTGGGCTCTGCAAGCGTCCAGCGTAACCCGTACATCCCCGACGACATCAAAGACAGCACTTTTGTGGACTTC
GTGTGGCTATTCCTTGCCTATATGTTGCTTTTCTCGAATTTTGTACCTATTTCGTTGCAAGTTACGATCGACTTCACTCGATACTTCCAAGCAAGAGCGA
TCGCTAACGACCCTGGAATGCGACTATACCCCAGTAAACCTTCCTTGCTCACTACAGACCACGCAACAGATAAAAAACACGTCGTTTACGTCCAATCTTC
CGAGTTGAACGAGGAACTTGGTCTGGTTGAGCACATTTTCACTGACAAGACCGGTACTTTGACCTGCAACCGAATGTCGTTCCGCTCTTGTCAGGTTGAC
GGGGAGACGTTCGACTTTGACGAAAAGGACGGATCGCTCTTGATCTTGGAACAAGCGGTTAATGAGACCATACTGGATGAAGATCCGGATGAGAAACCTA
CTCGCCGAAGAAACACTGTCAATTTGTCCTCTTTTCCACTCAAGAGCACGCCCATGCAGAGGTTTCTGCTCAATCTTGCGGTTAACAACTCGATCTGGCC
TAGCGCACCGTCAACTGGGTCGGGTTCTCCCAAATCTATGAAGCCTGTGGCAATGGAATACGCAGGCCCATCTCCAGATGAGCGAGCACTTGTCATTGCT
GCGGCCCAAGCTGGCGTTGAACTCCGTGGGCGTAACAATACGCGCGTAATGGTGCGTGTAAACGGGAAGGACGCGGAGATGGAGGTTCTTCATAGTTTTG
AGTTCACGAGTAACCGTAAGAAGAGCTCCATACTGTGTCGGGAATCGACTGGAAAGATTGTTTTGATGAGCAAAGGAGCAGATTCGGTGATCCTTCAGGC
TTTAAGCGAGTCAGCGAATAGACCCAGCGTTATTTTGCAAGCCAAGGAGCAGATGAAAGTGTACTCTGCGAACGGACTACGTGTGCTCTGTATAGCAGAG
CGAGAGGTGAGTGCTGACGAGTATCGTTCGTGGAACTCCCGCTACTTGGCCTTAAAGAATAATTCCACTCGAGGCGCGTCGGAGGAAGAAATAGCTCAAG
TGATTTCCGAGCTGGAGCGGCGGTTTGTGTTCGTCGGAGTGTCAGCGATTGAAGACAAGATCCAAGAAGGGGTTCCTGAAGCTCTGGAGAAGTTCCGAGC
TGCTGGAATTAAAGTTTGGATGCTGACGGGCGACAGAGCAGACACGGCAACGAACGTCGCGCATGCTGTGCGGTTAGTTTCTTCCGAAATGCGTTTACTC
CGACTGTGTGAAGGTTCGTGGATGGAAGGGTCCAAGCAAGAAGCAATTGATTTTCTTCAAAAAGAACTCCGAAAATCTCGAGAAGAAGGTGAAGTTAACA
GTATCGCCAGCTCTGTTCTTGCGAGAAGTGGCACCTTTAGACCCGGATTAGCTCTCTTGATCGACGATTTGGTTGTGGACGCTGTGACGGGCTTTAGTAT
TGAGAAGGAGTTCCTCGAACTTTGTATGCAGTGTGAATCTGTGCTTTGTGCTCGTATCAGTCCCAAGCAAAAGGAGCTGATAGTAGCAATGGTACGAAGT
TTCTGCCCGAACAAAGTCACGTTGTCTATTGGAGACGGAGCTAATGACGTTCCGATGATTCAAGGAGCGCATATTGGCGTTGGAATAGCAGGAGAAGAAG
GCCACCAGGCTTCGGATGCCAGTGATTACTCCCTCCCAGGCTTCAGATTCCTCCAACGGCTTGTGCTGGTGCATGGGCGCGCTATGAATCGGCGGATCGC
AGTGTTAACGCTCTACGTCTTCTACAAGAACGTGCTGCTCGTACTACCGCAGTTCTTCTTTGGAGCCTACTGCCTCTACTCGGGACAGAGCACGTATTTC
GACACTCTTTTACAACTATTCAACATTGGCTTCACTGCTCTCCCCGTACTGGTCTTCTCCGTGAAAGACGACGATATCTCGGCTCGCACAGTGTTGTTCT
ACCCGAAACTCTA