Description :
From Genome Similarity Track
Location :
Scaffold_53:279473- 280892
Sequence
1419 bases(100 bases per row)
CATGGCAGGGACGGATTCGCCGGGAAATAGCTCATTAAGGAAGAAAAATTTTGCTGGAACTAACCGAAGTCAAAGTGACATGATGCTAGCGCACGTGCTT
ACCGAATCGCGTGATATCATCGACCCCACACATATAGCCGCGACGCCGAAACATCTTTGAAACAGCGCCTTGTCGACACCACCAAAGCGTCAAAGATCGA
ATACGAAAGTATCGCATGGCGGATACGCCATTGTACGTAGTCCAGCCGAGAGGGAAGGGTTAGTACGCTGGCGGGTATCGCCCTTCTAACCGAAAGCGTG
AGGGGTACTCTAGGACGTCTCTTCAAATATGTGTTGGGCCTAGAGAAAAGTGATAATCAGAGGAGCGTCTGGAATAATTCCCCGAGATCGGAGATGTACC
ACTATGATCATACAGGATAATAACCCTGGCCTTAGCTATGTTTGCGTCGAGGGAATAGATGGTGCTTCTTTCGCTCAGGCTACGTAAGTTTACTTTTGCA
AAAATACGTGTGATCCCTCGCATGTTTATTGTGCAGCTTTTTATATATAATACGTCCCGGTCCTGCTTCTCGGCCAAATAAGAAATGGCCTACCAGCAAC
TACTGAAGTGGAGCCAAACCAGACTTATTCAGCCGAATAGAACTAATTTCAGGGCGGTGTGGCTTCCCGGGACAGCAACGATTGCTGCTATTTCCAGGGA
TGGGGGACGGACAGTCGTCTTAATCATGAAGTAGGAAAGAAAAATGGCAGATAAAGTGATGCTCAAACTGCAGCTTCGCGTAAGTGCAAAAGGGTTTCGC
TGAAGCCAGCATAGTTCTTCGAGGTATCGTGCAGTTATATCTGGCTCCGGCCCCGCCAAATGAAGAATAGTCCCCACAGCCATATCGTAATATAGAGTAG
GACAAGCGTACAAGTGGTAATTTGACGTACCTCGTGTTTGCGGCATTGTGATTTTTCAGCCAGCTATTAAAAGACGACCTCACAAAACTATGCCAACTTA
ACACGCAACCTGTCTTTGATGGCGCAAAACGCTTACATGTCCTACACACAAATGGGAATTGATCAAAGCAGCCGCAACGCTCTGCCGATGATCATGGGGG
CATATACAAGCGATGTGACAGACAGTGGGATAACTACGGCTGATCCCAAGGTGTTTCACCGTAGCCTGAGAGTCAAATGCATGAAATGCCTACAGCTACC
ATGGCAGAGACTGATTCGCCGGGAAATAGCTCATTAAGGAAGAATAATTTTGCTGGAACTAACCGAAGTCAAAGTGACATGATGCTAGCGCACGTGCTTA
CCGAATTGCGTGATATCATCGAATTCACACATGTCAGCCGCGAAGCCGAAACATCTTTGAAACAGCGCCTAGTCGATACAATTAAAGCGTCAGCGATGGA
ATACGGAAGTTTCGCATGG