Description :
From Genome Similarity Track
Location :
scaffold_215:27947- 29847
Transcript NameFunction/comments
Pl_107575hypothetical protein PHYSODRAFT_349537

Sequence
1900 bases(100 bases per row)
TCACACTCTATTTGTCCTTTTTGCTTTCCTCGGCCTTCTCGGCCTCTTCCTGCTCCTGCTCCAAGTCCTCATCCTCTTCCTCGCTATCACTCGAGTCCGC
AGCGTTCATCACCTGCTCGAACAGTGTGGGCTCATTATCTAACTCCAAATCCTCTGGATGCGCCTTGTAGACTGGTAGTGAGGATGCGGGGGCGACGTTG
AACTGAAGTAGATCAAGCAAAAAACCGTTAGAACATGACTAGAATCACACAATATCAAAGTCTCAAGTACGAACCTTTGCAACAGCGCGCAGGTCCATGC
CGACGTATGAGTCGCTCTTGACGAAAATATCCAACTGGTATGTGCCAGCCTTGGGAGGCGCCTGCAGCTGTAGTTTCTGTTCAACCACGCGCTCCTGTGA
GGTCATCTTGGCGAAAGCGTGGAGGTGATTCATCTTAGCATCACCCACTACACAGTACCAACGCTCCATCTTCGGGTACGGGAAGCGTGGGGCGTAAACC
AAGTCGCACGTGTCGCCCTCCTTGACATTCTGACGTGTAAGCTTGACAGTGACCGTCATAATATCACCTTCAGCAATAAACTCCTCATCCTCCACACCAA
TCGAGATCTGCAGTTCCATGTGGGGCATCATGTCCAGCACCTTGGTCACTTCTTGACGGTCCTCCTCGGACAGGCCATTCAGACCCTTACGCTCCTCGGG
CTTCATGGCAATGTACTGGTGCATGCTGCGCACGGCATTCTTACCCGTAACAATGTGCTTGACCTCCGACTCTGTCAAGTGCGGCAACTGCAGGAATGGC
GGGTCCTTGAACCAAAGTCCCTGGGTCAGGAACTGCTGCATCTCCATCAGATTTAGTGTTGTCTGGAGCCACGACTTCATGACCGAGATCTCGAGCATAC
CGTCCACAAGTTGAATAGCCTTCTTGAGCATGGCGTGGAGGTCACCCTGCAGCGTAGGGCTCAATTTTTCACGCAGGAAGTGCGCGTGGAGTAGCAAGTT
GGCCTTGGCAATAGCTGGGTGGTTGTACTTGGGCTTGGCCATCATATCAGTCTGTTTAAACTTCTTGAACAGTCCTCCCAGTTCCGCATCGTCAGTAGAA
CGACGCGGGATCTCACGGAACTCGGCAGAACCAGCCAAAATCTCCGGCAAAATACGGGGGTGCGAGTGCTGCGACATAGCAAAGTTATAGAAGCCGTACG
TGTCGTACATGATCATGCTGTCTCCGTACTTCTTCGAGTGCGAGTACCAGAGTGCAACACAACTCGGAATGGCCACTACGAGAATAATCAAGTACAGGAA
CAGCACAATGTTGTGGTTGGCCGGATCCAATAGGAACGTGGGCAGACCAATCGACAATTGCAGAGCTTGACGGCCGTCCGGGTTGCCGTACTTCTCGTAG
TTGGCCTTCGCCACCTCGTCCGTCAATGCTTCGTAGGCCTTTGCAACAAGCATAAACTTCTGTTCAGCCACTGCGTCGCCCTGGTTCTTGTCTGGATGAT
AGAGCAGACTCATCTTGCGGTAAGCACGCTTGATTTCGCGCTCTGTAGCGCCTGCTGCAATGCCGAGGATGGCAAAAGGGTCGAACGACTTGATCTCCGA
GTCGTCCTTGAGCAGGAACGTCATGCGCACGAGCGCGTACCAGACGGCAGCCAATACGACGAGATTAAGCACAAAGGGGAGCGAGAAAACATTGCGGAAA
GCGGTTTTCTCGGCCTCCAGTTGCTTGAGTTTGCGCAGTTCTCGCTCACATCGCACTTGGCTCTTGTCGATGAGTCGGTCCTTGAGGAAGACGCCGTAGA
GGATGCGACGAAGCGACAGGAACGTCACGGGCACGACATATAGCGCGCAGAGCGACACGGAGAAGTAGTAGAAGGCCGAGTTGTCGTACTCCAACATGGT