Description :
From Genome Similarity Track
Location :
Scaffold_1:2794665- 2796313
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00727hypothetical protein
Phypa_INRA-310PPTG_00728hypothetical protein
Phypa_INRA-310PPTG_00729hypothetical protein

Sequence
1648 bases(100 bases per row)
ACTAAACTGTTACGCTTGTCAGGTGATCGAGGAACCTTTTACGAAAATGCCACCTCAAGGATCATTGGCAGCACTTCCAAGACATCAGGTGAGACTCCGT
GCCGTGTATTTGAGTGGTATTGCACATTGCTGAGCTGATATATCCAGGTTGCACGGATACAAGTAAAGTCAGCAAAGCAGATCACCAGGGCTCAATCGGC
ACAACCTTCACCACTGCAAACGCACCCCAACTCAGCGAAACAGCAGCTACTCAACAACAACTCCGAAGGAAATGTGCGAACTGCAGTTGCTGTAGATAAA
CAGATTCAGACTCAAGAGCAAGATGATCAGTGGGAATGGCAGCGCGTCTGGAAAGGTGCATTCGGCAAAATGCACCAGCAATTACAAGTGAAGACAGAGG
AGACGGAGGCACTCGCAGCCGACAACAAGGTGCATACTTTGTTGATTTTTTCATCGTATTTGCTGTATACATTGACAAACTCTTCCGTTTTTTTCTAGGA
GCTGCGTGCCCTTGTAACCGGCTACAAGAAAGCTCTGGAAGAAGCCGAACGCAACCAGCGCGACATCGAGGCCAAGCACCTCGCTGAAATCGAAAACCTT
CGTGCGGTGCATTCTCTAGAACTATCAGATCTTCAAGCTCGGTACCGCCAAAAGTTGGAGGAAGTGACGATGCAGAACGATGAGAAGCTGCTCAGCAGAC
GACGACAGAATAATTGCATCCGTCATGCACATGCACTCAGCAGTAACACCTTGGTACGTCGATGATTTTGATCTGGCAGTAATTCGAGTTGTTGTGTAAC
CGGAAATTTTGCTTATGCAACAGCCCAGAGACGATCGCGCCGACGCCAACGCAGATTTCCTCCAGTACATTGATACTTTCTACTCGGACACACTAAACCT
TACGGCGGCAAACAAAAAATGACAAGATACGTAACAACCTGAATAAGTAATCACATTTTTTAACATTAGTTTGTCATTCGAATAAGTATACACTACCAAT
ATTTTACCACTTTCAATACTCTATTTGACTAAAGGACAAGCATGTCGACCAAGACTCTGCAGGGAGATCCGCGCCGCCCCGGTGATCTGCACCCTTTTGT
GCGCGAGCAGGTGGATCCGGATGACGCCCCCGGCGACTGGTACGCCTTCTTTTCGCTCGTGCTGGGCTTCCTGGCCTTCACGATGAAGGTGCGTTATCCC
TCCCCTTCTCGGGAGTTCCTTCTTGGTTTACTGAATGGGCGCCTATTCAGTTGACACGAAACGCTAATGGTTTGTGTGTATACTTAGTGGAAGGAGCTGG
CGTGGGGTTCGCTGCTGCTTTGCTTTGGCTCGTTAACCAACATGAAGTCTCAAGATATGAACACGACGCAAGTGGCCATGTCCTTCTTCTTCTCCACATC
GGCCCTCGTGTCCGCTTACATGGGTACCATGCGTCCAGGCATGCCCATGCCATCGGGCCAAACAGTGGAAGCCCCCGCTTCGTAGAGTCAAGGGAAGACA
AGAATCGAGTTTATCTAGCAGAGAAACTTCGCTGCTGTAAAAATGAAGCTGTTGGTACTGTGCTGTTAGACGTGGTTTGATATTGTTGTCACACATTCTG
GAAGTAACGACTAAAATGATGGGGGTTATTTAGAATAGAAACGCTGAT