Description :
From Genome Similarity Track
Location :
Scaffold_20:279388- 280498
Transcript NameFunction/comments
g8220.t1RAW39101.1 hypothetical protein PC110_g4667 [Phytophthora cactorum

Sequence
1110 bases(100 bases per row)
CGTCAGCCCAACCCTCGGCGTTGTGCAGTCTCACGTCGGCGTCCATGTTGGGCGAGTTCTGAATGGCGTACAGCAGCTTGGTACGCAGCGTTTCCTTGCT
CGTGTAGGCCGGAAGTCGCAGCGCGAAGAAACACGTCTGCGCGTGAGGCAGGTACAAATCCGGCTGGCCGACAGCGCCCGGGTCGTGGGCGGCCTGCACC
TTGAAGTTCATCGGGAAGTCCTTGGCGCTGTTGGGCATGCGGCTGCGCGCCCACACGAAGCGCAAGAAGGACGTCCGCTCCTCGCTTGTCATCTCGCGCA
ACACCTCCCATAAGTGCTGTACGTGCGGCATGGCCTCATCGGCTCCCTCGCTGTACTCCGTGCATTGGCGCAGCAGGTCCACATCCACCTCGCGGCGTCC
ACAAATCAGCACCTCAAGCTCTCGCGGCGTGAACAACGGCGCCAGCTCCATGGGAAGCACAGACGCCAAGCCGTCCTTGAGCGCCGCAAGCTGTTGACTA
CTCTCGGTGAGCCGCGTTTTCTCCACAAGTTGCACGTACAGCTCCCGGTTCGCCAGCGTTACCGGCATTTTTTCACCTTGAGGAACCAACAGCACTTCAG
CACCATCGCTCAACGTCGTCGACAAGGTCAAGTAGCCAAGCACCTCCTCAGCCTCCTCAGTCTCGGTACTGAGCTCCTCCACACGACTCAAATTGTTAGT
TGTCGCGACATCAACGCTCTCGAGGTGCGCTCGGCTGACCTCAAGCCCTGCCAACGGTCTCCACACAAGCGCAGGTAGGTCCAATCCCATCTGCAGTCCG
TGACGAACTGCTGTACCGATGAGCTTTCCGAGGAAGCGATGTAGATCCAGAGCCATAGGTCCGTTTGCTAACAAAGCAGTGCCACAGGAAGGGTTCAACA
AGAATTTGTCCTGGTTGCTGCCTGTACCGCTGCGGCGGTTCGGGCACGGAATGAGCAGTGGCAACAAGCCTTGCTCACCCTTCGCCAGTTCCACGTTGTC
CATCTGCAGCTCGTCAACAATCTGCTCGAAGACAGCGCGATATGGACCGCCGTAGTCATTCACACCCTCACCCAAGAATTTCACCTTGAAAGCACGGCGC
TGACCGCCGT