Description :
From Genome Similarity Track
Location :
Scaffold_15:27931- 30334
Sequence
2403 bases(100 bases per row)
CATGTGAGATTCTGAACGCCGATGTCGACATCGAGATAAGCAACGAGCTCAAAGCTTTGATTTCAAATCCAGTGTATTGGAAGGGTGTCGCTGCGATGGA
GAATCTTTTCATGACTATTAGCTTCTGTTTGATGTGGTCGGAGGGAGACGAGGCGACATTTCCAGCCGTTTATGCGGGCTTCGTGGCGATCAAGTACCAC
ATAAAAACGCTCAATCGCACCGTGATGGACGCTTTTCTTTTGAATGACATAGACCATATGTGATCACTCTTATTCACTAGCGCTTCGAGCTAGTTTCACG
AAAGTCCATGGTCTTACATTCGTAACCGATCCATTATTTAGCAAGATGCGAGTCTCAATCGCCGCTAAGTTTGGAGAGCAATTTCTGCAACTAAGGAGAG
CCTCGTTCAAAGAGCATTCAAACGCGGCAATCTCCCGTCTTTTAAATAGTGACGAAAACCTGAGTCGATCAATGTTGAGCGAGTTGGCCCCTTTCATCGT
GCGCCACAAGGAACAAATGAAGACGACTTCAGTGATATTAAGTTCAAATTTCGGAATTTTGGACGTCATATGACGACTTGTGCTACGGATGCATAAAGAG
TCCGTTCTCTGCTTTGCTCAAGAACGCTTTCAGAGCAAGCGAAGAGGAGCGGAATCAACAGGCGTCCAAGCGCGTTCACAGTCGCTCATGTGCTCACTTA
CAAAAAAAAACAAGGTCGAGACCGGTACTGCTATTCTTTGTAATTCAAGTCAGCTCGACTACCGAGTCGATACAACGCGAGATACCAAATGCTGCGGGTG
GCTACATCAGCTCGATGATGACAACGGAGAAGACTGAAGAAAAGACCCTGGATAAGTAAGATGATGACACTGGAAGCATGATTGACGAATTTGACCTCTT
GGACATCTCTGGTGGCACTGAACGCATTGCTGACAAGAATATCTTCGACGTGGAGGTGGAAGACGAGAGTATAAACTTCAATTAAGGTTTCCCAATTCTG
GTACAACACACTTTGGTATAATAGGGGTGTAAACGGTATTATAACACGACGTCGCTTATATTTCAATTATACACAACCATTGGCACAACAAAAGCAACAT
GCATATTATAACGAGGACTGTTATGAGCCGTTGCGGTGCCAGAACTTCGCGACGGTCGAATTAGATCGTACGTATGCTAACATAATGATGATCTCAAGCT
ACGCACGATACTAACTACGTGACACTTTTTTACGATGACAGGTTCGTTGTCATAGCGCAAGAGATACTCCTTAAAGGTCAGATTCAATGGGATGGGGTCG
TCTCTTTGTACAATAAAGGGCAGAGGCCAGAAGAAGCCATCTAGAACGTGACGCACTGAAGACTAAGTTTAATCGAATAAGGGCTTCGTCAGGTGTTGTC
GCGGACCTACCACATTGTCTTTAAGCGCAGATCTAGATGGTTGCTGGCGTCAGAACTGGGGACGACAGTACAGGTTTGTCCCTATTGTCTGCCAAATCCA
TCGATCGGCCTCTCACCCTTGTGAAAAACAAGATCCCAGTGCAAGATGAAGACTAGGATGAGCTGACATATCTATTCAACCAAGGTACAGCTGGAATCGT
GCGGACAGCGGCGCACCTATAAAATCCTTTGTTGATCTTGGCAACGTCCCGAAGCCGACCGGGGACCATGACTGCACCGAGGAGGTGAAGCGTGCAAAGC
GTGCCAAGTGGCAAATTAACACCATATTAGATGCAGAAGATATGAACGACACAATTTACGAAGAGAGCGACAGAGGCTGCGCGACATTTGATGGCAGCGC
AGAGTGAGACAAGTAATACGGAGGCGACTGGACGATACTGAAAAAGAACTGGAGTGCCAAGGACCAATTCGAGGAACCAAAGGATAAAGATCAAGCGGCA
GCAGCGAACCTTAAGAATAATACGGTGGGTTCATCTGAGAAAATTATGGTTTCTGCTTCACCTTTGTTCTCATTTTTGCCAGCGACTTCACCATCCGTAA
ATCGAACGCCCCAATGTCTCGTTCCTACGAAGCTCAAGAAACGTGCAGAGAGTAATTCCGCTGCACCACCAAGACTCGCAGAGTTGTCTGTCACTTCTCC
TCTATCGCTTACACCTGAGCCGTTAAGCTAAGTAAGTGTTCAATGAAGTTAGTGATAACCAGATATGCGAATTCAGCTATGTATAGGTTTCAAGCACTGC
AAGAAAATGATTTTGCGTTGATCGAGCTTTGGAGGAGCTTTCTAAGCCGTAACCACAGTCCTTCTCGACGACTAGCGGGTTAGTGGACATCATGATAATG
TAAATGCAACAAGATTGAAAGATTCCTAATCTAGACATTACGTCGTGAGGCTGATCACCGTGCGGATGCTGCTCGCCGTGAAGAAGACAGAAAAGAGGAG
GCA