Description :
From Genome Similarity Track
Location :
Scaffold_244:2793- 4109
Sequence
1316 bases(100 bases per row)
GGTGATAAGGCCCAAGGTGACCGACCGACGTAGAACGTAGGATTCGTGTGCATCTTACGTGGCAGTTCAATCGTGTATGCGTTGCCTATGCGGCGCAGCA
CACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTGGATAGTAGGACTAGATCACC
TTCGTTGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTTTTGTCGGTCCACTGCTTCTGCAATGGAATCTTGCACGAAATGAACAACCGT
TTCGCGAGCCAGTATGAATTCATTTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGGAGCGCACTGTGGCAAGGTCAGTGACCTGGGTAGTAAGAGCA
TCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTTGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGATGAGTGAGAGCTGA
CTTGGCGTTCGCTCGAATGAGTCCCTCCCCCCCCTCAAACTAAAGTTACACTCTAAGAAGGTGGGTAGGCGTGGGTGGCGTAAGCCATTCACGAAGAACG
GTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCTAATTCGTAAACGAATGGACATAACCCCGAAG
GATTTGTTCAAGAACGCGGTTTGCACGTTATGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGCGTTCCGAGTGTTTTGAACACG
GATCGCCAGAATTCCGCAGTGAACCGTGGGTCTCGATTAGAGACGAGTTCACGAGGCAACCCATGACGACGAAAGATCGTGTCAATAAAGACACGAGCAC
ATGCCGATGCATTGATAGATTCATTTACAGCGACCAGGTGAACCATTTTACTGAATCTATCAACGAACACAAGAACACCTGTATCTTGTGTGGGTCTGCG
GGGAATCCAAAGACAAATTCCATTGTGATTCCCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGGGAAGGAATTGAATTCACTCGTTG
ACATACTTCGCATGCGCGGACGTACTTTCGCACGAACTGATACTGGTGGGGCCAGTAAAAGTCGCGACTAACTGTGAGATATGTCTTCTCTCGACCACGA
TGTCCATCAGTAGGTGCATCGTGGTACTCATACATGATGCGCAGTCACAGGTCACCATGATCCGGTACGACGACACGAGGCGTGTCGCCGGCAACGGCTG
TATACTTCAGTAAGCC