Description :
From Genome Similarity Track
Location :
Scaffold_6:279281- 283335
Sequence
4054 bases(100 bases per row)
GATGGCCTCGACTTTATATTCGCCGGCAACTTGATCTGGTTCACAGCTGTCTTCAGGCAGCAGCTCCTCGTCGAAATCGGGTCTTGCTTCATTAGTCGCG
TCTAGTACTAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTCGACACATGCACCACTGGGTGGAAGCGATACCCACTTCGGTCTG
GCAGTTCCAGATCGTACGCAAACGCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCG
TTCCATGTACAGCCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCGTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCC
GAGTGTTCATTTCCACTTTGTTGAGGTACAGCGGCTTTTTCCAGTCGACTCAGGGCATCATTATGCTTTTTAGCCCTTCGCTCTTTTCTACAGCCTGATA
ATCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCTAGTGCGTCAGACTGCTTGCCGAGTCCTCCTTTGAGTGATGAC
GACATTGCCCTCAACGTCGACTGCGCATCCCAACCATGAGCGAGGTAAAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTA
GCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATT
AGCCTGTGGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGC
CGTATTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGA
ATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGACATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCG
TTCGGCTAGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCG
TACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCT
CTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTC
TTCTAATAACACGAACCGGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTGAAC
GACTTCTGCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACTGGGTCAACATCTTCCGCAATGGGAAATACAGTCTTGT
GAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGCTCTTGAGCTTTTGAGACATCCTCCGAGTGTTC
ATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCTCGAAA
TTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGACGAAACATCTACCGAGTCTTCATCCGGCT
CGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCGATTCCAGCGCTTCAGTGGC
TAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGC
AAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAG
CCTTGACACCGTTTATCATACCTGTATACTCTGCCGTATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCT
CCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAGGACATGACGAATCCGCTGTAATTACGGGAAAGCCTG
GCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGC
TTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCC
GAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTACCAGCTGGACGTAACAGATCTTCAACAGC
AGAAGTAACGCCAAAACTTCCTTCTCAGCTGGATGGTAGCTCATCTCGGCTTCCTTAAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCAT
GTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGA
AACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAG
ACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATAGCCG
CAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTAGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCT
GATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGT
CGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTA
CCGGTGCTTCGCGGTATGCCGCGAACTTTGTTTGAAACGAACCCTCGGCGCTTGGTCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTC
CGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCAAAGGGC
ATGCGTAACCACTCAAAATGTCCTAGTGCGCAGACGAACGCTGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCA
GCGAGCAGAACCATAGGTAGCGCTCGAGATCTCTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTA
ATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTAAAAAGACGATCAGTCCTGCACGCAAT
AAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTTGATATCGCATA
CCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATTAGGATGTGCT