Description :
From Genome Similarity Track
Location :
scaffold_1181:2792- 3919
Transcript NameFunction/comments
g11121.t1 hypothetical protein PHYSODRAFT_258317

Sequence
1127 bases(100 bases per row)
GGGTGAAGACCGAGCCACCCAGGTGACGGTTTGCCTTGAACCTCGCCGAAGTACAACGCGAACGTCTGCTTCCACTCCTCCACCTTCGCGCGGTCCTCCA
TGAACGCGGGGAAGTTGGCCATGTTGGACGCCGGGACGTCCCAGGGCTTGTTGGCGTTGATGTCCGTGCGCACACTGTTGGTCACCACCGACGTCTGGGC
CTCCTCAGACACGATCCAGTTCATGAACAACTTGGCGGCAGCTGGGTGCCTGGCCTTCGACAAAATGCCCATGCGCTGACCCCAGCCAAGGAACTCCGTG
CCGTTGGTGACAAATGTGGTCGCGTTGCCACGGACACTCGAGCCAATGCCAATGGCCTCGGTCCCTGCACTCACCAGGTCGCGGGCGACGTTCGTGCCAC
GGTTGAAGCTGACGTTCTGCTGAGCGAGGCCAGTCACCCAGTCCCACCCGTACTTCTCCACGTAACGAGTGTACAGGAACAGAACGGCATCGTCATCGTG
AGGGTACGACGAAGCGATTTTACCAGCATATTCCGGCTTGATCAGATCTGCCGGGGTGGCTGGTGGCGTTAGTCCGTCGAGGGCAGTCGTGTTGTAGATG
AAGCTGAACTGGTAGATGGAGTACGCCAGCCACGCGCCGTTCTTGTCCTTCAGTGAGTCGTGGATCTTGGAGAAGTTGGCAGGTTTGTACGGCAGGAGAT
CGCCATTCTTGGCCCAACGGGTGAAGTCCTGCAGTGTCTGGAGCGCCACCACGTCGGGTACCAGTGTGTCCGTCTCCAACTGATTGTCGATACGCACGTC
GTGGTACTTGCTGTAGTCGACGACAGCCGTAAAATTCAACTTCGGGAAGCGCTTCTCAATTACAGCGTGTAAGCTGTCCTGCGAAGTCGGCGTATCTCCA
CCATGGTACAGGACGAGGTTGCCGCCTTCCGCTATAGCATCAGCGTAGAGCTCATCGATGGTCTTGGTCTCCTCACCGGACGTGGATTTGGCTGCTGCGC
CAGCAGAGAGCAGCACAAACGCTGCGAGGAATGGGGCAAATAGCTGCATTGCTGGAACCCTCCAAGTCGGCGGTCGGTTTGGAATGACTTGATGCGGATG
CAGTAGATTTGAGAATGAATCTTCTTT