Description :
From Genome Similarity Track
Location :
Scaffold_70:279192- 282825
Sequence
3633 bases(100 bases per row)
CCAGCCACCCATCTTCGGCACGTCGAGATAAACGCGGAGGAAGAAATCGCCCTGTTCCTAACTGACGTAGTGAGGAGGAACTGGGCGAATTATTCCTTGT
GCTTGACATTAGCGCATCATTAGATTTCTTTAGCCCACCTAACAAGCTTGTTACGATTGTCTCTCTAACAACACCAGGGAGCTTGCATGCTCAATAGCCC
GTAATGACACGCACTACACACGGTTCCTCTTGTACGAAACAGGACAATATATGATATTCATGCCAACGTCTACTTCTTCCTTTACATACGCACGCTCGTC
AATGTTCGCGCCAGCCGTGGGTCATCTTCGCCATTTTGGCAGCCTCCGCTTTGCTCTGTAGTCTCCGGCTGCCGCTCCATTCCTGCCGCTTTCATCGGTA
GCCTCCGTCGTAGCCTCTGTCCCTTCTTCTGTAATCTCCGGTGTAACCTCATCACGCGGAGAGCTTCTTCTGTAGCATCCGTCGTAGCATCTACCGCTTC
TTCTGTAGTCTCCGGTGTAGCCACACCATGAGGGGCGCTTCTTCTGTATCCTCTTGAGTAGCCACTGCATCAGCTACAATATAGCGGTAGACCCGGCTGT
AGCCGGCTTCGTAGGAACCGATGAGGTTGTGCGCTGACTCCGCAATCGATCTGCCAATCGGGCCACACGCGAGAGCTCATAGCGTCGTCTGGGTCGGATC
ACCAGGTCTGGTAATCAACATCGCAACGTAGAATCAATATACCACTAGTACAATGTTACAGAGCAAAGTACACGCTCTCGCTTACCTGTAGATCACAATG
GCGCTCATCATGATCGTCTTCGGCCATGGTCCTTGGTCACTTGGGCGCGCTCGACGGGCCCCAACAAAGCTTGCATTGCGACGTCTTGAACAGCGCAGTT
TCGGAATGAAGGAAAGTACGAGTGGCTGACACGCGGCGGTTTTAGGCTTCCATCCGAATTTTCAAACCTGTTGGTGGTTTATACTCGTCCGTCTATTACC
GCGGAATAAACCCCGTTTATCTTCCCATCGCTAATCTAACAGGAAGATGTGCACAATACCGGCTATACAAACATCCATATGCGAAGTTCGAAAGAGAGGA
CAAGTTTGCTGGATATTATGTCCTGTGACAATGCTTATTCTATAGGATACAGAATACGGGGTTAGAGGGGTTAAGCTGGATATATAGATATCCTGATATT
GATTCTGAGTACTATTTCTAGTTTCACCCGTGTAGCGTTTCTTAGCTCAACAGGCAAAAATATTTGTACCAAGGTTGAATTTGTACAATATTGCTGAAGC
GAATGGGCGATTTATACAGTTCGACTATGGAGAAGGAAACTATGGCTAGATTCGCGTAGCTAGTGCTGCATCAGATCTTGAATGCATTTAACTACGGGCG
TAATTGATGGAGCGCACTGGTGCATTGTACGAACTGGGACCTTTCCGGGGGAGGGACGACAGGAGTACCTTGTTAAGACCCTCTTTGAGGGTACAATCGA
TTGTGTAATTCATTCAGGTCGCTATCCAGGTCAAGGAGAAGTAGCAAATTGATTTTATAATGGAATAATCGTGAAAGGGTAGAATCACTACTGCGTCTAT
AAACTATTATAGATTAATGCACCTGTGTAATATCGGTGTGAAAACCTCGGATCCACACGAAATAAGGATGGGCGATTAATGTAAGGGAACAGAATTTCGC
GTACGACAGCCTTTGGTAACTAAAAAGAGCTTCAAGATGAGCTATTAAAATTGCGTCTAACTCCACTGCTAATCAGATTCATTATACACTACTTACAAAC
AATTTGTAAACGCTAGTGTTAGCAATACAGTTAATATTTGTGCGAGAACTACTGCCTTACCATCAATTCTATGCAATAACAAATAGGAAGCTTGGCACAG
AAATCGACACGTATTTATGCTTGTAACGATTACTTGAATCCCGATGAATATATCACATAAATTACAATAAAGCACGTGAATACTACAAAGGTAGTAGCAA
CCGTACCTTACAGAAGGAGTGGTTAACCCCAGTCGGGCATTTCGTTAAGACAAACAGGAAAAATGGTAGGAATAAAACGAAAATAACTGGAGATAAGTAT
ATCGTTGTTGCTGTCTTGAGCGTAGTTGTAGATGTAGATCGTCAGACGGAGGGTCAATTTGAAAGTGGGGCCAACTCGAGTCTTCATCCGGTTGGGTTCT
CGTTTCCTACAGCCCTCGTAAACTGGTGGAGCTCAGTAAACTCACTAATCCTTATTATACTTTACAAAAACCAAGTTCTTGTACTTCATGCTTCTGTTTC
AATCCGAGATTAGAAACTCCGATCGGTATGTCAAAAGTTGGTACTTATTCTAAACCTCAACACTCCCACAAAAGACACATGCAGCCGATACGCCCCCAAT
AATATAACTTATGGCACCATCCCTAGCAAATGTGCATTGTATGTTCTGTAAGCATGCGGCTTGCGAGCATATATCCGAACCGGTATATTTGTATCTTACC
ATGCGCATTGTGGGGTGCAAATTGAAAAAGCCTATCCTTTTCACTAAACGCTTGACCTTATCTTTGTAATAACTTCAACAAACTTCCAAAAACTCGGATT
TGATTGACAATTTTATAACTGAGGCCATTAAGTCGCTTCCCCTTTAACGATACCCCTTGAAACGTAACACTGCATCGTGGGGGTGCAAAACTTAACTCAA
CTCTGACGGTTGTACTTGTCCTACTTATCTTAAGATCGTTAACTTGATGCAAATCAAACTTGATAGTTAACTCAGTGTATTTGTAGTGCCACGTTATAAT
TACTGCCGGTGCATAAATATCCCCTAAGGTTACTACGCACTCTCATTGCTTCTTTCAGCGTCTAAGTTTCTCACACCCATAAGTTCACGTAACGATCAAG
CGCCAATTGATGGATGTGCTACGCGGGAATATGGTGGGGAGCTACCAGACGGTGGAGTCATTCTTGATCCCCGATGTACTGCAGAGCTCCAATTTGCACC
ACGGCTTCGAGAAAACGGAAGATGGTCTCTTTCAGCGTGTATGCTTTTTCCAAGTGCGTGTCTACTTGCTGTACAGTTTTGTCGACATGTCATCGGGCTG
GCCGGTACACATCTGAAGGGTGACATCAATGAGCGAGTTGATTTTCTTCTGGCTACGACAAAAGACCTGAATGTGTTTGGACTAGCTCTTGTGGCCAAGA
AGACTACTCCAACACGGGCGTTGGTTTCTCCAGGAGATGAAATCAGCACTTACCATCCTTGAGAATATGTGGAATCCGGTTTTCGTATCCTATCGTCAAA
TGGTATTCTGGTATTGGTGATGAAAATCTACCCACGCAGTGGTCATCGGTATTGCGTACGCCACATATTCTCAAACACTGAGAAGAAGGGGTCAGCTCTC
ACTTCAAGCGAGGAAGCGATAATCTTTCCGATGGCACGCAGCGAGTACGAGAATGCCTACAACTACTACAGCCCGAGACCGCGTGACTCATGTCCACTTG
CTGCAGAATACCTGATTGGCATCGATATATCGCATTGGGAGCCTTACACGTTCAGTGATGCTCACAACCAGCCGTCATACGACAAGGTGACTTCTAACCG
CAAACAACTGGCTCGGAGATTCGTGCCGGACTT