Description :
From Genome Similarity Track
Location :
Scaffold_227:2791- 4593
Transcript NameFunction/comments
g15405.t1hypothetical protein

Sequence
1802 bases(100 bases per row)
CAACGAAGGCCTTTATCCTTGCCTTCAATGAGTTCCAGCACCCCTCAATGGAGTTAAGCATCGAGCTGTATGGACCCAGTCGCAGCACCTCCAGCGTGTT
AATGTTTACAATACCGTCTTGGACAAGCATCTGCTGAGCCAGGTTCTCCACATGGCTGTGCGCGGGAGCATTGTCTGCGACAATAACGATCTTCTTGTTG
ACCTCGAGTTCCTCGTACTCGTTGGAGCAAAGTGTAGCCATGAACAAATCCGCCTAAAATCGGGCATTTCGTTCCTTTTTGATTGATCGTTCGTATGGCT
TCATAAACAACACCTCCGAATCAGAGGAGACCGCACCTTGAATGTGCAGGTTCTTGCCTTGTGATGGTGGAAGTTGGACGACTACGTGCTCACCAATGCG
TGACTAACCTTTCGTTCGAGACAGATAGAGATTGTAGTTAGTTTCAACCTGGTATACAATTATATTACCTTTTTAATGTGTTTATTGAGCGATTCAACAA
ACGCCTTCCGCTTGGCCTTGCTTTTCGACGAGTTCATGGTCGCTTTCTCGACACGCAGGCGCTTGGTAGAGTATTTAGCATGCCTTGGATGGCTCGATGC
ACGGATGTGAGACGACAGAGACCACCAAATCAGACTGCAGGTAGTCGCTATACTGCTCAAGCATCCGCCTACAGTCTTCGTCAATGTATTCTTCAATCTT
GTTCATGACTTCAACTGTCATCTTGATAGAGGCGACTCTCAAGCCGCCGTGTTGCTTAAGGTCCCTGTTGACGGCTGGAATAGTCCGCGGGGCAGTATGG
TAATTTAGATCGTTGTTCGTGGCGATTTCTTTCTAGTTACGGCCGTCGCGTAAAGCTGTCACGACACGAACCTTTGCCTGTTCTCGCTCGAAGACCTTCG
CTGTCTTTGTGGGGTCCGGGGAAGAAGGCATATCTGGGAGTGAGGGGATCTCTCGTTGTTATCATCTTGTGAGAGCCACGCGTTTTGGCGCGAGCCAACA
AGCCAACGCGCCGAAACGAGTCGCTTGCAACTTGTCCAGAAACGTTAGGGGGAAATTTGCAAAACAAGAAAAATGAACTTATGATATTAAACTGAATACG
TCATCAGTCGTTTTGATTAGAAATCTTTACAGCTTGACCGGGAAATTGTGTAGTTGTTCATCGAGAGCTTACGCTCTCTAGCCCTTCCTCTGTGCAAAGG
TGCAAAGTCGCTACTACAATATAAGTACAATCAGACGATAACCGGCTGAAAGCAACATACCGGCGACTATGTTGTTAGGTATTGTAATGGCCCCCTCCCA
TTTACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGTAGGTACAAAGGCACGCGGCTAGCGTGTGCCTCGTTGTCATCCTGCGATTGGTTGAAAG
TGGGGAGCCAGACCCATTTCGACCAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGGATCCGAGGGCCACCCGCCCCGGTCCCAATAATAAACCAG
AGTTGATTTTACCCTAGACTAAACACTTGGTCTCAGTATACCTGAGCTTATTGGACGCTTCCTCACCGCTACGTGTAAGCTAGTGACGGGCACTCACCTG
GCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCCATGACCAAGTTCGAGATGAGTGAAGACCAGCCCGCCGGACCTCCAGTGATGACCCTGGAACACG
CGGCCTTCCCCCATCTCACGTCTATCGAGTGGCAAGCGTTGCACCGGTGTCCGGAGAAACCGTCGTCACGTCGCTGCTGAGCTCAGCGACCCCCGACCAA
CA