Description :
From Genome Similarity Track
Location :
Scaffold_10:279061- 282364
Sequence
3303 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTATGTCTCGAGACCGTTTTCGGCTCATTACCAGATTTCTGCATTTTACTGACAACGAAGATCCTGCG
GCTTCTAGTGATAGGGGCTGGAGAACTCGTTCGGTGTTGGCAACGGTGGAAACCACATTCAAGGAGGGGTATGTCTTGGGTTCAAGAGTGGCTGTTGATG
AAGGTATGTTACCTTCGTTCAATCGGCGCAATCCGACACGCATGTACATGAAGGACAAGCCGCATAAGTGGGGAACCAAGTGCGTCATGACGTGCTGCGC
CGAGTCGGGCTACTGCAAAAGGTAATGCTGACATAGTCACGATAAATTATTGAAGCTATGCTGACTTAGAGTACATTATTTGATGCATGACAGAGTTGAA
GTCGACGTTGGGCGAAAGAAGGACAAGGAGGGTGCTCAATCGATGGACACAAAGAGCGGCCCGGCGGCTGTCCTACGAAATATTGCGAGTGTTTTCCGTG
GACTCCCTTACCAAGGAAGGCGTCTCGTGGTTGCAGATCGGTTTTATACTTCTGTACCGCTAGCGCAACAACTGCGGACTATGGGCTTCAATTTCGTTGG
GACTATAGAAAAGAATCGAAAAGGGTGGTGCAAAGGGGTTGAATTTCCTTTCAAGAAGCGACCAGCAAACTTTACAAGGGGCTCCTTCAAAATGGCGATC
GCTAAAAGCAATCCGGGTCTAGTGGCACTGGGCTGGGCTGATAACAGATCGGTTTACTTCCTGGCATCCCAAGTTGGAACAGCTATGACGACTGACGAGT
GTTCAGCGGCGTGAAAAGAATGGAGAGCAGAGCACTGTTCCATGCCCGGTGATTGTTGCAGAATACCAGCGCTTCATGGGTGGTGTTGATCGCTATGATC
AATTGCGACTTCAGTCGTACTCTATGCAATATGCAGCAAGGTAAATGCTACCCTGACAATGTCAACTTATGGTCTCTAATTTATGCTGTTCTGTATACCA
GATTTCAGAAATACTACAAGAGTCTCTTCCTTGGGCTATTAGACATGGCCATGGTGGAACGGCGTACATTTGTACATTCGCTGTTGTAGGGAGGAACAGA
GCAAGAAGAAGATGTCGCATTACGTGTTCTTGGCAAGAATGCACAAGCAACTTATCCTCTAAACACAGACAGCATTTACAGAGACAACCGGATTATCTCG
ACCTACTAATACAGTTACTGAACAAGTTACTGTACATGGCGGGCATGTACTAGTTCAAACGCCAGATACGCGCATGAACAACGGTGTCCAGAGGCTGAGA
CAGCGCCAGTGTAAAGTCTGCTCCTGCTACAAGCCTGAAGGTAAGCGGCGTGGGGGGGCATCGACATTCTATTGCCCAAAGTGTTCGGAGGACAAGAAGG
GTGTGGTGACGCTTTGCAACAAAGTCCGAGGGTATCCAGCAAACGAGATATGGCATATCCTGTGGCAGAACGGTGCGTTTTCGCCAAAGGGTAGTCACAT
TCGGGACCGTAGTCTTGCCAACCCGTAGCTAACCTTGTCAATACACGTACCTTCACAATCTCAACCATTTATTGGCACCGTACCTGCACATGCGTTCGCC
TCTGTTAGCTCTCGCTTGGCCATCCAGCTACTGCCACTATGCCGCTATAGTTTGCACCGCTGCTTGGGGTCTAGTTGGGGAAAGGAGGGAGATGTTTGTC
TGT