Description :
From Genome Similarity Track
Location :
Scaffold_58:279053- 280452
Transcript NameFunction/comments
Phyci_228963conserved hypothetical protein

Sequence
1399 bases(100 bases per row)
ATGAGCTACAACAACAACcggcgtggcggcttcggcgggcgcagccgcggtcgcggcaaccgcggcggtcgaggcggctacggcggcgggcgcgggggct
acggcggcggcTCGTCCGTGGGCAACGAGGTGTGCCGGCGCTTCATGGACGGCGGCAAGTGCGAGTTCGAGCAGACGTCGGGCGGCCGGCCGTGCCGCTA
CCCGCACTTCGTCAAGACCATCGGCGAGACGCGCGGCCACAACGGAGCCATCAAGGACGTGGTCATGTGGGCCGAGCGCCAGCAGCTCTTCACGTGCGCG
GCGGACGCCAGCATCAAGCTCTGGGACTGCGCCACCTGGCAGGAGATCACCACCATCAGCGTGCAGGACGCGCTGCCGCCCTCcgccaacggcggcagca
acgtcggaggcggcggcggcagaggcggcaacagAGACAAGGCGCCGCACACGGAGGGCGTCGTGGCGCTCGTGCTCTGCGGGCCCTTCCTCTTCGCGGG
CTTCGAAGGCCGCTTCCCGCCCAACCCCAAGGTGTCCGTGGGTATGGTGCGCGGCTGGAACCTCGAGAACGCGCAGGCGCCGCCCTTCGAGTTCCCGGCC
TCGGAGCTCATGCCCTTCGCGCACACGATGAACGTGCAGGCGCTGGCGGTGGCCACCGACACGACGGGCAACGCCACGCTCTTCAGCGGCAGCGCCGACG
GCTCGATCCGCTACTGGCAGATGGACACCGCGACCAACCAGTTCAAGTGTCGCGGCGTGATGGAGGGACACGTGCGCGGTGTCACAAGACTCAAAACGTT
CGCGGTGGGCGGCGCGCCCATCTTGGCGTCGGCCAGTGTGGACTCGACGATCCGGCTCTGGGACCTCGCGACGTACCAGTGTGTCAAGGTGCTGTCGGCC
GAGGAGAATGGACACACGGACGCCGTCATGGACCTCGAGTTCTGGGTGAACAACAACGAGACGTTCCTCATTAGCGGCGGTTTGGACTGCGAGATTATCG
TGTGGGGTCTCACCCCGCCCTTCCAGCAGCTTTTCAAGGAGACACAGGACTCGCAGGTCACTGCTCTTTGCGGGACGCAAGATGCCGCGCAAGCTCCGAT
TCTTCTCATTGGCATGGCGGTGAGTTAGCTTGGTATTGATGCGTCGTTGACTTGTTGCCAGGATACTAATTCTTAACTGTTGTTGGCGGTATGATGCTCA
GGATGGCACGATTTCAGTGAAGGAGCTGCCATCGTTCGCGTATAAGACGACACTAGGCGCCAACCTCAACCAGGGCCACCAGGATGCTGTGCGGCGCATC
ACGACTGGCCCGAGCAATACGTTCTTCTCCACTGGTAATGATCGCAAGATGATTGCCTGGCAGATCACCGGCGATGCTGCGTCAATCCAGTCCAAGTAA