Description :
From Genome Similarity Track
Location :
Scaffold_13:279033- 280720
Transcript NameFunction/comments
g18371.t1XP_008900984.1 hypothetical protein PPTG_08614 [Phytophthora parasitica INRA-310

Sequence
1687 bases(100 bases per row)
CCGCGTAGTTGATGAGGAAATCCACACGTTGGTACTTGGAGGCAATTGAGCCGCACCACTCAGCGATATCTTTTTGTGTTCGGAACGACTACAACACAGG
TAGCATGACACCACGAGGCGTGTCCTCGCTCTCGGACGGATCCGGAAAACGCCCAATATGCGTGGCGTTGAACTCGTCCAGCGCGGACATACTCCTGCAT
AAGGTACACACGAGTCAAAACAGTTAAACGCCGAACATTTTCCATGCCAACGTAAACCCATACTTGAAAGCTAAGAGCACATTCGCTCCCGAGAGCCACA
GCTGTGTCGCCACAGCCGCCATTGCCCTGTTGTCACCACCAGTAATCACCACCTACAGGCAAACCGCAGCAAACATTTCGCTTAGATAGACCTCAGCTAT
CTTTCACCCCCGTGCTTGCACGCACCAATTTGTTGAAAAAGACTGATTGCCATTGCGTGGCCAAAGTATCTTGATACAAGACATTCGAAGTCAAGCCGTC
GACACCATCAGCAGCATCTGGGACAGCGTGAGGGAGCGCTCCATTGCGCAGCAGCATCATGCCACCAGCCGAGTACACGGACGCAGCCATCGATGCGGAA
TCCTTCGCGCTCACGGGGGAGGTCTCAAGCTTTGCACGCTTCCTGTCGCCTTCCAAGTCGTCGCGCACATTGATATAGTCGCCAAGCGCTCGTTTCTGGA
GCTCGCTGTGGTCAGCTGCCGGGCTGGAACGACTGCCAAGAGTCTGCAACTGACTGTACAGCCCGTTATTAATCTCGGTACGAGCATTGCAGCGGCCTTC
ACGCAAGTTCTGCAGGAAAATCTGCACCGCCAAATCTCCTTCGGCCTCGCGCTTGTGCTTGAGCAGCCGCATGAACTCCGGGTGTTTACTCATCAAATGG
TTCTCGATGCGTCCGCGGCGGCAATTGAGTCGACTCCAGACCTTGGTCAACTCGCGCTTGGACGCCGGGTCGTCGCACAGCATGCACACGATCACGTCCT
TGTGTTTGTCAGCAGCAGCTGCAGAGGCCCCACTGGTCGTGCGCACCGCCTTGACAACTCGGCCGTCCATCTCCGCGTCCGGCAGCGAGCGCTCGACGAT
CGGCAGCGAGTGTAGCCATCTCTTCTGGAAGGTGAAGACGCGCTTGCGAGAACCCGTTGTTTTCGGCGTCTGCTGCTGGCCGCACGAAGCAATGGGGGAT
GAGATCGCGTCGACATCTTCGGAAGGCACGTCGGAAGGAGATGTGCGCATCACGGGGGCGGAAAAGGAAGACGACGACGTGGGGGAGCCCGCTGCGCCGA
CAGCCTTGTCCGTCATGGAGTGCAGAGACGACGATGAGGTTGGCGACTTTAGCGCAGATTTGTATATGGCGCTTTGTATGCAGCAGATTGGTACAGATTG
AAATTGGTGGCTGGTACCTGGTACCGCAGCTTAGGTACGAGGGGCGGGAGTCCCCCACATAGTTATACACATCTATCTACAAAGGGATATCCTACAACAT
AATTGAACAAATAAATGTATGTATCCCTATGAACAGTGATATGCAGCAGTCATTTCATTGAATCATTCTAATCTGAGGAAGGAGTGAAGTCGAGATCGAG
AGTGATGGTGCAGAAGTTGCAGTGTCAAAAATCAATTCCCACAGGTCGTATCACCGGCCAATCGCTATTAATCCGTAGTCGCGCAAA