Description :
From Genome Similarity Track
Location :
scaffold_697:279- 2913
Transcript NameFunction/comments
Pl_102916conserved hypothetical protein

Sequence
2634 bases(100 bases per row)
GCAGGATGTGCTGGATCTAGACCCATCGATTCTAACACCATATCTGGCGGCTCAGCTAGACGGAGCATGTAAGTCCCGCCTGCTGTTGGTAAGTTGTCGC
TCGACCGGTGCACAGTGTCATGCCCGCGTCTGGCTGCTTGCTAAGCAGCCAGAAGCACTTGTCACTGTGACGGCTGCCTTGACGGGCCAGCAGTTACAGT
GACCATGTATTTATCAGTAGGGAACATGCATATAGTTACAGTGAACATGCATTTAGGTAGATAAACATGAAGTGCCACAGAAAAAGAGAAAAACATGCAG
AGTAGCAGCAAAGGAAAGTTGCTTGCTTGTTGGGTGCAAAAGGTGAAATGCGTGCCGGGTGCAATGAAGAAAATCGTTGGCTTCCGGGAAGACTCGGCTC
AGCGGAAAGAGAAACACGTTTTGTCGGGCGAATCTATTTCATCCTTATAACTTTATGTACCCATGACGGTATAAAACGATGCAGATACCCCCTTCACAGT
CGATATAGTCTTGCCACCAAAAATTGGCTGCAATCCTTAATACCTAATGGGTGCATATATTATTAGAGGTAGTCAAGTATACAAGTGCACGTGACGACGC
CGACTTGTACGATCATGTCTTGGACTGCGTCCTCCTGTGGGGGACGCCATTCAAAAAAGACAGTAAAAATATTTTCTGCAGTGTTTTATACATAACAGAA
TAGGGGTACTCAAGTATAGGGGTACTCAAATAAAAAGGTACTCAAGTATACAGACCCCTTCCTAAATGATATAGTCTTGTCACCAAAAATACCTGTAATA
CTGTATGCATCATGGGTGCATAAATGAATAGAGGTGGCATGTGACGTGTGAGAATCCCTCAAATTACGAGTGGCCAATCGTCGATGTCGTACGGTCCTGC
GGCTGGAGCTGCGGCGGCGTCACCACTGTATCGCACACTTTGTGTGCGTTCTGGCAATGTGGTGGTACTGGGGATGCAGAAGACTGCGTCGGTAAGTTGC
GCCGGTATGACGCTCTTCCGAGTTTTCCAGGGGAACGTGGAAGTCTTGGGCTTCCAGCCGCCATTGGGCGTCTACTTCTCGTTGCATTCGCCCAAATGGA
ACAACCTTTTAGTGATTGAAGGACGACCGGATAATGAAGAAACTCAAGCACCTTTTGGACCTACCAACGCCAGTTTATTGCAAAGTATGGAGCCGAATTT
GCCGTCTGAAGCTCTGAACGAGGACGAGGAGATCGCTGCAGATCGATTGGCCATGCAACTTGTGGACAATTTTCCCATTGTGTTGGTGCTTCGAGCTATC
CCTGTCACCTACGGAAATGTCATGAGTTTCTATGAAAATACAAGACCCGAGAAACCTTCGTCGGTCCTGCCTGGTTTCAAGATAATTGTCTCGAAGCACA
ACCAAAATTTGTTGAGTGAGATCACTGCAGACTTTGATTATACAAGTGCTGCGCCACCGAACACAGATCTATTGCATCATGACTGGAAGACTCCGGAACG
TGTGTTGGCAGAGCTCGTGGTGGTGGATTCGTTCAGGACTTTGAACTTTACTGAGCCCTGGCAAGCGACGGTGGACAGATTGCAGGCGAGTCTGCTGTCG
GAAGAGAACCCGACGTCGCAGAAGATCGTCGTGTGTGGTGGTAAGGGCGTGGGCAAATCTACGTTTTGCAGATATCTGGTTAATCGGTTACTCGGGAAGT
TTGGCACTGTTGTCTTCCTTGACACGGATTTGGGTCAAAGTGAACTCACACCGTCCGGGCTTGTGGCACTTCATGCGTTAACGACGCCGCTGCTTGGACC
AGGGTTCTCGCACATGAAGAATCCGATCAGGTCATTCTTCTGCGGAAATACAAACCCAGGCAATGATCCACTGTACTACATGAAGGCAGTCAAGAGCTTG
CTGCGTTTGTACGAAGTCAAATGGGGAAACCAAAACAGCGACACCTCGAATCCTAAGGTGCCGTTGGTAATCAACACAGACGGATGGATCAAGAGCATGG
GGCACGACCTGCTGTGCAGTGTCATCCAAGAGACGAATCCCGACCACGTTGTGCAGTTAGTGGCCGCGACGAAGAACAAACAGTTCGATGTCCCCACGGA
AGGAAGGTGGTGCATTCATGCTGTCCCGCCTTGGGACCCCGTCGGTGTAACACAACCTCCTCGAAGCTCCAAGGAACTACGAAGCTATCGTTTTCACTCG
TACTTCCTGTCTCGCACCCCTTGCAACATCGCGCGGCCACTGTTACAGAATCTCCAAGTTCTCTCAGAGAAAAACCGTGTAGACAGCGACATCTACCGCG
CATATGCCCAACTCACACCGTTCGTCGTTTCGTTCAACCAGGTCGATATTGCTTTCGCCGGTTGCTCGGTAGCGCCAAGTCAACTCCTGTTCTCTCTTAA
CGCCTGCATCGTTGGTCTCTGCGTTAACCCTGACTACAAACCGTTCGAGCAAGTCGAATCCGAGCCACGTGAGGGACCACCACGCATCGTACTTCAATCT
GTTCATGCTCCATGCTTAGGCGTGGGCATCATTCGCGCTGTGGATGCAGAGAAGCGTCAGTTGTTCATTTTGAGTCCGCTTCCCCTCGCAGTGTTAAAGC
GTGTCAATCTACTGGTACGCAGCAATATGCCGCT