Description :
From Genome Similarity Track
Location :
Scaffold_207:27899- 32230
Sequence
4331 bases(100 bases per row)
TTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACCATGACAC
TTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCAAACAGC
GTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTGCTGCCATATCGATGACGCTAACAGAACAGCAGAG
AGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAG
CTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGG
GAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTAC
GTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCCATTTGCACG
CATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAAC
TTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCA
AGCAAGCGGACGTCGAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTGCTGCCATGTCGAT
GACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGAT
TGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTG
TAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGC
CCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGG
CTTCATTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCG
AGTAAAAACGGACCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATG
ACTCCTACACTTCGACTATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAA
TATGACTACTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAA
CAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATA
TGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTA
GTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTT
GTGCATACACGCACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATC
ACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACCATGACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCT
TGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCGAACAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGG
ATAGATCGTATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTG
ATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAA
AATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTT
TTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAA
TCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCACTAATCCATTTGCACGCATCAGGTGTATATGTAGCCGTTTGACCTCGCCGGTC
GTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACATGACACTTTAGCTGCCTTCTCCG
CAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCAAACAGCGTGTGCTTTATGGATGT
AAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAACAGAACAGCAGAGAGGTTCATCGACCATCT
TGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGTCGAGCTTGTCAAACCGTGCAA
GTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGTAAGGGAGCCGTTGAAGCAGTG
ACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTCGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGGTTACGTTCAGGTCGTAATGTT
TTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCCATTTGCACGCATCAGGTGTATATGTA
GCCGTTTGACCTCGCCGGTCGTCCGATACCACGATCCTATCACAGTAGTGAAGTTGTCCTCGAGTAAAAACGGACCGGAAAACTTGACGATTGCACCATG
ACACTTTAGCTGCCTTCTCCGCAGATGACGTTTGTATTTCTTGATCGCTGGACACACCCATGACTCCTACGCTTCGACTATCAAGCAAGCGGACGTCAAA
CAGCGTGTGCTTTATGGATGTAAAGGCAGAAGCCAATCTGGATAGATCGTATAAGATACGAATATGACTACTGCCATGTCGATGACGCTAACAGAACAGC
AGAGAGGTTCATCGACCATCTTGGCGTCATCGGTGGTGTTGATACAGCCTGAAATACAGCAACAGACTCTACAGCGCGGTGATTGCGATGTTTAAGACGT
CGAGCTTGTCAAACCGTGCAAGTCGGAAACGAAGGGCGCAAAATATGGCGTGATGGTACATATGGATAGCTTGGGCGTTTGTGTAGCATGGTGTGTGGGT
AAGGGAGCCGTTGAAGCAGTGACGAGCCGAGGAATCGATTTTTTGTGACGTGTGGTGAAGTAGTTGTCAGCTCGCCAGTTTGCCCGAGTGGTCGAAGGGG
TTACGTTCAGGTCGTAATGTTTTCGAACGCGTGGGTTCAAATCCCACAGCTGACAAGGCCTTGTGCATACACGCACAGCAAGGCTTCATTAATCCATTTG
CACGCATCAGGTGTATATGTAGCCGTTTGAC