Description :
From Genome Similarity Track
Location :
scaffold_17:278962- 280625
Transcript NameFunction/comments
g10668.t1 homebox and aldo/keto reductase domain-containing protein

Sequence
1663 bases(100 bases per row)
ACGGCATCTAGTCGGGAACCATCCACGAAAGCCTCGGGGCGCTGACAGTAATTGGACTGATGTGTGGGTTGCAGGCGGTTAGCGCAGCGTCCCAGCTTTT
GGTTGCGCCTCGAGCCAATTGGCGTCCCCTTTTTGACAAGGTGCTTCCTTCCCTCACTTGCGAAAATGACTTTTCCGAACCGCGCCAACTACCGCCTGCG
CTCTCGAGAGAAATCCCAGCAAGCGGCGCTGACGGCTAACGACGTCCCGGTTGAGGCTTTCGAGGCATTTCGCCATGTGACACACGAGGACGTCATGGCC
GCGGCCTTGCAGTGCTGCGACGCCGAGGAGGAGGAGAAGGCGGCTGCTCCAATGCACGACCACGCGCTGCTGCCGCTCGCGCACAAGCTCCTGGCCATGA
TCGCGCAGCCGGCGAAGCTTCTCGCAGCGCTGGTCGTCCACTGCACGGACCGGACGTCCAAGCAGGAATTCTGGGTCAAGGCGGTCGCGTACCAGCACGC
AGAGCTGCGTACAGTGTCCGACTGCTGGTGCATCCTTATTGCGGAGTTGGACGACCAGAGCGAAATGTGTCCGACGGATGTGGCCATGCTCAAGGCGGCG
CTGTACCTGTGGCGGCTGTGGCAGTTTGTATGTCTGATGTGCGTGGACGCCGTAGCGTCCGTGGAGGAGACGTCAACGCTCAAGCAGGAGCAAAAGTGGA
CGACCACGCTGCTGCAGAAGCGTCATGCACCCGCCTTGAACGACCAGAGCGCGGACGCACTGACCCAGGGCATGATCCTGTCGGGCAGCGGTCCGGCCAA
GCGCTCGCGTATCACCAAAAAGTCGAACGAGTTCCTCGTGGCGTGGTTCCTGGCCCACAAGGACAACCCGTACCCGTCGCCCGACGAGCGCACCGAGATC
GCGGACAAGACGGGACTGGCCGAGCAGCAGGTGCGCAACTGGTTCGCCAACATGCGCAAGCGCCACTGGAAACCCAACCGCTCGAACGCCAAGAAGCCGC
GCTGTCTGCTGGACTACGTCCTGCGTCAGACCGAAGCCTGAAGTACCTGTACGACCGATCGATTGCTACCGATCGATGTAGCAAATGAACTCTGCGTCGT
CGTACATGTAAGACGGTAAGTTCCAAAAAAGAAATTGGCGATGCTAGCTAGATCCATTAAATATCCAGAAAAATAGGCCTCTGTTTCAAATTCAGAGCGG
TTTCGCGTCCGCTCTCAAATTGCAACACTATGGTTTTCTAGAGGCCCTTTGCCAGAATGTAATATTCTATTCATTTAACGAGGTAACTTTCGAGATTTGA
TGGGGTCGACAAATTCAGAGCGGAGCGAAAATTCGTTTTCAGAATCACTTGAACAAAGTATAGTGAAATCGACAAATTGAGAGCGGTTGTTTGTAAACCT
GTGGAAATGGATATTTGCTTGGCATATGGTTTTACAGGTTTGGCAAACTTTTCGCTCTGAATTTGTCGACCTCATCAAGTCTCACAGGAAAGTGTGGATC
TGGATAATTTTGATTTTATCCGGGATAGTATGTGAAAGTCGGAATGCAGGACACGCGCCCTGCACGAAACGTCTCGTCAGTGCGGTGGTTTTCTCGAGAC
GCCGACGCCGAGGACAAGGTCGTGTACTATCTTGGCCTGGCCGCTAGACCACGGGGTTCGCTG