Description :
From Genome Similarity Track
Location :
Scaffold_3:27885- 28953
Transcript NameFunction/comments

Sequence
1068 bases(100 bases per row)
AGTGTCGATCGCGGGTCCCACCCATGGGCCAAGTAGAATGGCGTGTCGCCACGAACTCGATCCTGGGCCGTGTTTAGAGCGAACGTGAGTCGCTCCGCGT
ACTCGTCCCAGTCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCGTTAGAGTCTGCACCATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCG
GTACGCCATCGTAGCTCTCTGTTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGATCATGGCGGATGACCTCA
CTCGCGCCGAAACGTCGAAAGACGCATTCTTCGTAATTCTCGGCAATCGTTTGGGCCGTGCGAGAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAAA
GATCAACCCAGATTAACAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGTCCATGGCGATCATTTGGAATGGGTACGTAGCTTGTAC
ATTCCCTGGCGATTCTCCCTGAATGAGGGGGCGCCCTTTCCCAGTTTCACAATCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTC
CAGTGGAAGTGCGCCTTGACGCGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGATAATGATGCAGGACGTCTTGTTGTAGCG
TCTCCGGGATGACCAGCCGCGCGAGGGAGTCCCGGTCTTCGTCCGATTGCGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATC
GCAAGCGGTCTTGGCGCAGGACTTAGCATCGTTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCT
TGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCTCGGCACTCGTCTCGACCGTCGTGCAGATCGCGTTACCGCTG
ATACACGAGCTACAGCGTTATTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGG