Description :
From Genome Similarity Track
Location :
Scaffold_52:27880- 35772
Transcript NameFunction/comments
Physo_137213hypothetical protein
Physo_109008pol protein
Physo_137215reverse transcriptase

Sequence
7892 bases(100 bases per row)
TGGGAGCCATCTGCGCCGCAACCTTCTCGGACTGAGCTTCGTCCAAGGGGTTGGAGATGACGGGGCCCAGGGGCACGTCTTCTACACGAAGCGGCGAATA
CCGCGGCTCCGTGAGCTCGCGCAGCTCGTAGAGACCGGAGGAGCGTTCACGGAAGTTGAGGGAACGGGTTCGGAGTTCGCAGCGGTGGCCGCGGCTCCTC
CCTCGACGGCGCAGCGCGCTCTGCAGGTGGACGGCTCGGCGAGCGCACAGGAGACGTGCGCGCGGGGCGCTCTTTGTCACGACGGCTCGGAGAGCCAACT
GGGGCCGGCGAGCCTTCTTCACGGCGTGTCGACAGTGCAGCGGGGCTGCCGTAGCTTTGCGTCAGAGGAAGCTTAACAGACTCACAGAGTCTCAGCTTAA
GATAGCCCGTTCTAATACCAGAACGTACGAGTCCGTACACCTTACGGACTCCAAGAGTTAGCCCTTAACTCTTAACTGTGTGAATCTCACACTGCATGTA
TTTCCCTTTAGCGCGGCCAAGCCGCCTACGGTGTAAATGTATCCGGTTCACTATCTAGCATAGTGAACCCTAGTCATATGCATAATTGGTGGCTCTGAAG
CAGTGTACTCATTATCCTACTGATTTAGGTTAGACATTGTGTACCCACTTCGTAACCCTTCGGGTAACTCTCGTGTAACCCCGTTACACCCTCCCCACCA
AACCGTGGACACGGGTGTTCACGCTTAACGGTCAACCTCCGGGTTTTGTTCCGTCAAGCCTCCTTCTCGAACGAGTCAATCCACATCGTGTGGACTTCTC
TGAGAACTTCTCGGCGGAACGCGCCCTCACATGACTTTAAGTCATAAAGCCTTTTGGTATTTCCACCGCAGACAGCCTCTCGCGAGATCCGCCTCGGAGC
CTCGCTCCTCTCGTGCTGCTGCACTGCGTGCCTCCGAACCTTCAAGAACGCTAGCGCCCGCGCGCAAACCCTCGACGCCTTCCAGGCTCGCGGTGTCCGA
GTACTTCGCGGCGCAACGCCAGAAGCACAGTTTGCAAGCCCCAGCTCCCCTCAAGCATCAACCCGCCAGATCATGGATCCTAGGGAACACTTTGGTGAAG
AGGGCGAGGTGGACGAGTCCATGCTGGGTTCTCCAAACCGAGGAGATGCGTCCCCAGCCATGCGACGCACCACGAGCCGCAGCGACGCTTCACCCACGCC
GACGACACGCCGTGAAGAAGGCTCGCCGGCCCCAGTTGGCTCTCCGAGCCGTCGTGACAAAGAGCGCCCCGCGCGCACGTCTCCTGTGCGCTCGCCGAGC
CGTCCACCTGCAGAGCGCGCTGCGCCGTCGAGGGAGGAGCCGCGGCCACCGCTGCGAACTCCGAACCCGTTCCCTCAACTTCCGTGAACGCTCCTCCGGT
CTCTACGAGCTGCGCGAGCTCACGGAGCCGCGGTATTCGCCGCTTCGTGTAGAAGACGTGCCCCTGGGCCCCGTCATCTCCAACCCCTTGGACGAAGCTC
AGTCCGAGAAGGTTGCGGCGCAGATGGCTCCCATGCGCTCCCTGAGCCCCGAGCGGCGGCCTCTGCTGAACCCCGGCGCTGCCGCCTACGGCTTCCGGCC
TCGCGACCCCGCGGAGGCTTGTCGCCAGCAGTCTCTCGCGCTGCACGCCATTGGGCCCACGGCCCGTACTCCGGAGGAGCTCGCACTGCGTACGTCTCTG
CGAGAGCGGCTCCACATCTACGACTGTCGCGGAGTATTGCGAGAGACTGCGGCTGCAAGCCCAGCAGAAGTCCGTGCCCGCCATGCGGACGTACCTGGTC
GTACTCAGCCCGGGGGAAGACTCGATTGAGTACGAAGCTCAGTTCGAGTCTTGGGCCGAGCACAGCCGGAAGCTCAGCTCCATGGACGCTCTCCGAGCCA
GCTTCAGTGAAGCGGATGTTCGCATTGAACGCAAGCTCCGCTTCGATTTCGCGAAGGTCCGAGCCAAGCGCAGCCTCTCGGCACTCGCCCAGCCGCAGAC
CCAGTTTAGCGCTGCGCGCTTCGCTCCTTCGAGCACTCCAGCCGCTCCTTCCCGCGAGGGAGTGAGCGATGTGGCTCGGGGTCAGCCTCGAAGCAATGTG
GCTGACCCAGCAGCTCCCCAGCTTATTGCCGGGAAGCGCGGGACGGCCGGCGTGCCGGCCTTGAGCCATCGGGGCGCTGGTGATCAAGCTGATCAAAAGC
GTCCACGACGTCTGGGCAGTCTTGGCGGAGGGGCACCTCAAACTCCCATGAGTTCTCGGAGTGAGAGTACCCTCGCCATTTCACCAGATACTGGTTTTGA
CCCCGGCACCGCCGCTTCGCCAGGAGGCGCTCCACATGGTAATGTAGATTCCCATGCTCATCGAGCAGAGCCGGTGGAGGCCGCTGGGGGGCCCTTTGCG
ACTCAAGGTGAGCTCTTGGAGGCGCGGCAGCAGGCGGGTCGCCTTCGGGATCATATCCATGACTTTGATGCGCGTCTGGGCCGGACTGCCACCGAACTCG
ACGAACTCGCCGAGCGGACGCGATGGATCGAGGTGCCTCGAGAGGTCTGGGACCGCCTTGGGGCCCTGGAGGACTGGGTGCGATACTATCGCGATCGCGA
TGAGCAGCGTGGCCGGGAGCTCGGGGAGCTACAGCGTCAGCAGGCTGTCCTTCAGGGTCAGCTCGACCTCCTGGTCGCATGCAGGCTCCGACTGCTGCGC
CTCCTGCGCCTGCGGCTCTCGCTGTGCCCGCGGCACCTCCAGCGCCGATTCTTCCGCCTGTGCCTGCGGTGCCCGCGTTGATGGCCGCGTCCTCGACGAC
CGCGACCTCCTCACCTGTGGCCTCGTCACCCTCGGTGCCTCCATCTGCACCTGCATCGGGTCCTGGTACGGCTTGAGCAAGCCCACGTAGACGACGGGGT
GCGTCCGCATCTTCTTCGGAAGATTGAGTGTGTATGCAAGGCCCTTCTTGGCCACAACCTTGAAAAGGCCGATGAAGCGCGGGCGCAACTTCGTCTTGAA
GACGGCTGACACTGCATGTGTAGGTAGGTTCTTAGCGTTAAGCAGCACCAGGTCCCCGACTTCATAACTTTCAACATTTCCTCTGCCTCTGGCATCTGCA
TGTTCCTTTTGCTTGTCTTGGCTTTCAGCCATTGCGTCACGCACATGTCGTAAGACACTGAGACGCGTCGACAAGAAAGCGTCACCCTGTTTACGAACAG
TAGCCGGGCTGACATCGGCTAGCCAATCAGCTAAGTCGGCTTCTCCTCCCCCACCAAGCCCGAGGCCACCACGTGGCGGCGTCAGCGGGACGACAAGCTG
TTCACGTAGAACGGCGTGTAGCCTGTCGAGGCGTGCACGGCGTTGTTCAACGCAAACTCAACGAGTGGGAGCATGGCGCTCCAGCGCTTCTGCGTCTCGG
CGCAAATGCTTCGGAGCACGTCCTCGACGACGCGATTCACGCGCTCTGTCTGACCATCGGTCTGCGGATGGCCCGCCGTGGACATGTCCAGCTTGGTGCC
AAACACCGCAAAGACCGCGCTCCAAAAGTTGCCCGTGAAGCGGGGGTCTCGGTCCGAGACAATCGACTCCGGGAGTCCGTGTTGTCGAAACACTCGGTCC
AAGAACAGCGTTGCTGTACCTTTACCATCGATGGTATCCGGCACAGCCGCAATGTGAGCCATCTTGCTCGGTTGGTCCACGAAGACCACGACTCCAGTGT
TGCCCGCCGCGTCCGCCGGCAGGCCAAACACAAAGTCCATACTCATGGATTGCCAACAGCCCGAAGAGACAGGCAAACTCGCCAACGGCGCTGCAGCATG
AGGTGACGACTTCACTCGCTGACACGTCTCGCACGTGCGCACGTAAGTGCTCGTCCACTTGTGCATCTTTGGCCACCAGTAGTGGGTGCCCACCGAGCTG
TAGGTCTTCTCATGGCCAAGATGGCCGGCCAGCGGCGTGTCGTGTGCCTCATAGAGGATGCGGTACTTCAGATCCTCATCATGAGGGATGACCACGCGGG
GCGTATCCTCGGGGCCACTGTTGTAGAACAACAGGCCTCCATCGAGGGAATAACGGTATAGCCGCGCGTGCAGCCGCACTGACAGTTCCATGTCCGAGTC
TTGAAACTCCTTGCTCCCCAGAGTGAGGCGATGCGGCTGAACGCCTTTATCGTCCAGGTGTATAGCGCACTATGCCGGACCGAAATGAATTCGGGTTCGG
AGTACCAGAGATTGTCCACGCGATAAGCAGCCCACGGGACACTGAATGACCCGGGCCTGGAACCGCTTGGACGCACCGAATCGCACTAATGCAGTCCGGT
GTTTGGCGTGTGTCCTTGTATCAACCCCTATAGGTATCGTTTACCTTTGGCGGACCGGATTTCACCGAGTTGAGTTGTTGCGATACAGAATAAAGTCTGC
TGGGTGTGTTCCTGGGATAAACCGCACCGAATTAACAGAAGGTCAGACCGAATGAAAGGGACCACAGTCAGATCCGTAATTCAGAATAACCAACACACAG
AAATACAATGCCGAGCTAAACGTCACAAAATATACAGCCACCACTTATCCTTTGAGACCCTTGGGTGGGGGGTCTATACACCAGTCAACTTCGGAGCCGT
CACCCACGGCACTGGTCAGCCCTGGATGCACACTCACTTATGCGCACCACCCTCACAGAATGAGGGAACAATACAAAATATAATTCAGTCCTATCACACA
GTAGTCAATCAATTCGGTCTGGGGGGGTGACTACCTCAACCACCAAAGACACACAGTAGGGAATATGAAATGGATGCCCGGTTAGAGCACGCAAATAGAA
ATTAAAGCTCTCACAGGTCACTCCGGGGCGCGAAACCCCAGTCACTGCCGACTTTGTCTTGGTACCTTTGAGTCCCCACTACACCAGTGCTAGCTACACC
AGTGAGGCCTTCGAAGCGTCCCTAAACTGGCTTAGACCGCGCGCAGACAGTCTCCTGGAGGGCTCTTGAAGACGTCAAAGTCGGGGTGCTACTTCTGCCC
CGAGCACAGAGTCGCCCGCGTGTTCTTCGGCAAATTGGTTTCTGTTTAGATCTTACGTTTGCCTAGCTATCTTCTATCACTTCGCTGACTTTAATGTAGG
TTTCACTATGCTTCGCTTGTCTTGAGTATGCTTGTGTTTCTTGGCAGTTCTTCAGTATGCTTGTCTTGGTTTCGGTATGCGGAGACTTGTTGACGGCGAC
ACTTGTTCGGGTACACTCATCAGATGATGACGGAGGTATCTGGGTACATCGTCTCTTCGTCTTGGAACTGGACCTCTCCCTTGGATCTGCGGCTCATTCG
GTGCTGCCCGTGGATCTTGGGGGATCTTGGTCTTGTCCGGTCTGGATCGACGCCGCTGTGCGAACACACGCGGCGCGCACTGGGCTTGTTCTTGGTGCGT
CTACATCCAGTGTGGGCACGGGGGGCGGACCGAATGAACGATCCGGTCTGTCCCCATCCGGTGTGGCACTACTTCATTCGGTACGCCATCACCGGGTGCA
CCACGATCCGGTCCGGACAACACGAGGCTTCATCCAGCAGGGTCTTGCGTGCGCATGATCGTGTCTGGGGGGCCGATTCAGTGGGGTAGCCCGACAACTT
GACTGAGCCAATGCAGGCAGTGGCCAGGATACGTTCGCTGGCCACACTTTCGCGCCTTGGGCCTATCCTCCAGTTAGGGAAGTCGGCGGACGGACAGGAT
GCGTGACTCCACACCGAATATGAGGGCTCATCAGGTGGGCGCATCTCCAATCCTGTGCAGCCTTCAGCTGGCGAGATTCGAACGCAACCACGCGCTCGCG
CCCCTCGGCGTCTGCTTGCAGCAGTGCACAGCCGATGGCAAAGTCCGAGGCGTCACAGACGACACTAAACGGACGAGCGGGGTCTGGCAAATCCAGAATA
GGCGCATGAAGGAGACTGTCCTTAATGGCCGCGAACGCATCGTGATGCTCGGTGTCCCAACACCACTCCACATCCTTCTTCAGGAGATTGGAGAGTGGCC
GAGCCATCTCAGCGTAGTTCTCGCTGTACTTGTGCAAGTAATTGGCCAAGTCAAGCCACTTGCGAAGATCCTTCTGGCTCTTCGCAAGTGGCCAGTCAAC
AATGGCCTTGACCTTGACCGGGTCGGCCCTCAGGCCACGCTTCCCGATGAAGCACCCTAAGAAGGGGATCTCTTCCGCTCCGAAGATGCATTAGTCAATG
TTGGCGTACAACTTGTTTTGACGCATGCATTCGAGCACAGCACGCAGGTGCTCCACATGGTTCTCCATATCAGTCTTTCCGTGCTCCGCACGACTGTGGA
CAAAGATGTCATCGAAGTACGTTTGCGCGTACGCCCGATGGGGCCTGAAGAGCTGCGTCACAAGACGATTAAACGTCGCTGGCGCGTTCGAAAGCCCTTG
GGGCATCACCAACCACTCCCAGAGCATGTCGCTCGTCCTCATGAGCAATTGGTAATATCCACCGACCAAGTCGAGCGCACTGTACATCGTACATCCTGTC
ATGTTGTTCTGAAGAACATCCTTCCGAGGAATCGGCGTCTGCGCCGGAATGGCATTCAGCTCGTTGAAAGCATGCACGATACGCCACTTGCCATTCGGCT
TTCTAACACAGAACGTCGGCGTAGAGTGTGGAGACTTCCTCTCACGCACCATGCCCGCCTCGTGCTTCGCACGGAAGAACGCGTCAATGACGTCACACTA
CTCCTTCGGCGAGGGCCACTGCCTCGTCACGCAGTACTTCGTTCCCGGAACAAGATCGATTTCGTGTCGAACACCTCGATCCGGAGGTAGCCCCGAGGGC
GGCTCCTTCGAGACCACGTCCTGGTAATCATTTACCACTTGATACAAGGGATCCGACGGGTCCTTCATGATCGCCGATCCGCTCCGCGCATTCAGCGCCT
TCTTGGTGTCTTCCAGGACAGCTTCATCCAGAAGCGAGGACGAGTTCAACTCTTCTTCGGGTCGTATGACCACTACATCGGCCAAGTCTCCAGCCTTCAA
GGCTTCGCCGAACTCGGCCAAAGACATCTCGTCCGGCTCCAGGAGAGCAGACAGTGAGGGCAAGTCGTCGAGGTTGATACCTCCGTCGACGTCTCCCGTC
ACTCCATTCACGAATGTATAGAGCTGCTCGCTCTCGGGTGGAGCCTCACCGCTCGACACACCCTTCTCGACTCGTGAGATCGCAGACGCCTTGCGTCTCG
CAGCCAGCGCTTTGCAGCGCTGCCTCCTCTTCATGGACACCGTCCGCCCTGAAGAGCTCCGTGATTTCGCGTGCGTCTTGACGCCATGTGTCACCGCCTC
GTTCAGCTCCAGGGGAGCTCCAGTGTCTTTATCGACACTCAGCGAAGAGCTGCACGATCCGCAGCCTCCACTCAGTGGATTACGTGCCACCCCCACGATC
TTTATCCGGGCAAAGCCCATGGTCCTTCGGCATCGCACCGACCGCGCCGTCGCTGGCACGCAGCAGGGCGCCGCCCTCCGACGCACCCCCGCTCAGCGGA
ATTAGTGCCGCTCCACCTGCCGTCCGCAAGTCAAGCTCGGAACGCTCGTTCTCGACACACGCAGTCCCCACCAACTCGGATACTCCGATGTCCAGCACAT
TGACCGACTCGGTCCAGTGCTCGCGCCAAAAGCGCTTCTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTCCACCAGGAGAGAAGTGCGTAGC
ACCAAGGGTCTCCGACCTCCAATTGATCCAAGGCTCGTGGCGTTCCAGCCATGCCATACCAAGGATGAGATCCTATCTCGAATCGAGGGCTAAGACCAGA
CAGCGTTCCACGCTATCGAAATCCAAAACCTTCACGCCCAGGTCCACGCGAGACGAACAGTGACGATGTCACTTCCGCGCGCTATCAGCACC