Description :
From Genome Similarity Track
Location :
scaffold_37:27866- 29897
Transcript NameFunction/comments
Pl_111484hypothetical protein PHYSODRAFT_387004
Pl_111485conserved hypothetical protein

Sequence
2031 bases(100 bases per row)
GGAGAATGGATCAGTCGGCCATACAAAACTCGAGAGGGGATACACGTCACCTACAATGTGGAGCGTGCACGCTATGAAGGTCTGCCGGACGAATGGAGAA
TGCTGAACCATCAATTTGGAATACCGCTTGAAAAAGTCCCCAGGCGGATGGTAGAAGGATACGAAACCAAACTACCCGCTGTGCTGGAAATGATGAAAAC
CTGCTTTTTAGCACACAATGGAGCTCGTACGGAAGGAGTATTTCGTCTGGCTCCAGACAATAACGAGTACATCGCGGCCAAGACTGCAATCAATGACGGC
TCCTTCGAGGACTGCTCCGACGTCCACGTCATGGCCTCACTCATAAAGGTTGGCATCAATGAGAATTATGACGTTTGAAGCTGGTCTTATGTTGTTTTAT
TGCTGCGATCAGGTGTGGTTTCGAGAACTTCCTGTGAGTCTTTTCAACATGATCCCGGAGGAGAAGATTTCTCTCACGTGCGCACTTGTGGTAGGAAAAA
TGATTGCTCTACTGTTCTAGTTTGGTGTCAATAACCAACATACAACATCGTATGGTGGGTGTCTTTAGGATCCGGAGCCCACGGTTGTGATGCAGGCTCT
GACGACCTTGCCTTCGTTGCACCGAAGCGTTATACTGTGGCTGCTAGACCTGATGAATGAAGTCGTGAAGCACGATCAAGATAACAAAATGACCGCCAAG
AGCATCGGTTCGTTCTACTTCGTTTCATCCGAGTTGCCTTCGGCGTAACCTTCTACCTATGTGCTGTAGCAATTGTAATGGCGCCAAACTTGTTCAGTGT
GAAGAACTCGGATGCTGAGGCTGTGGTCGCAACGTACCGTCAAGTTGCCGATTTCTTGCAGATATTACTGCAAGCCAGATTGCAAGAGCGTCAGGAGCCG
TAAAGAATACGAGATCATGCGTAGTCGTTTTTATTGATATCGTTCGTCGGAATAATTTAAAGCTCAATGCAAAAAGGAAGATGCAAGCAAAAATAAGGCG
ACCGTAGAGTGTACAAACTGACTGTCGACACATCTATCCGAGCAGTGACACTGCCTACACTAGACAGCCATACTCGGGGGAGATGTGGCGGAAGATATCA
TCTTCCAGTCCTTCGAGTCCATTAGACGCGATGGAGGGTGGTTCCTCGTTCGAAATGTTCGCTGAAGCGGTCTGTTGAGCCATGGCGGAGGCTTTCCGCA
TGGCCATCGTGGGCGACGGCTGCAGTGGGAAGAAGTCGTACGAAACTGCGTCCAGTGAATAACCGCACGACGGATGGTCGTTCTCGCCGTACGGGTCCAT
AGTAGAGGTGCTAAGCTCGCCGAACGGGTCGTACATGGCATCAAAAACGAAGCCTGCTTGCGCAGGGATCATCCCGGTTTGACTGTAGTGGTTGTACTGG
GCTGCTCGACTGTACTCCACGGCCGCGTTCATGGTCATGGGGTTGCCGAAGAACAAATTCTCGCGGTGTGGCGAGGAGGCTGAGGCCGAGGACGGCGAGT
CTGTGAAGAGGTGTTTGCGTGCCTTGTTCCTGTGCACAAAGTGCTCAACGCCTGGTCGGGGACTCTGCGAGCCGCACGAGTCCTCGTCTGAGTCGTGATC
GTCTCCTCCATCAGCGTCACCTTGGAAGAAGTGGGCGGGCAATGCTTGACCGAAGGGGTCGATGCCGTACGTCTCGGGTGACAAGAGGCGCTTAAGTTGG
CTCTGGTACCCTGCGAATTGCCTCAGTTGCTTGTCCGAAAGTGGCGGTCCCGATCCGTCCTGGGCTTGTTGCTGGCACTGCTCCAGCTCCTGCAACGAGC
GTTTGAGGCTGCGCACTTTGCGGTAAGGCCAGTGGCGGATACCGATGGCTCGGCATCGCTTCTTGAAGGCGGTGGCGCGTACGCCGAATTTCTCGGCCGC
CACCTTGAGCGGCAAGTGGAAGTGGCGACTCAGCGCCGCGAAGTTGCACGTCGCCACAGGCAGTGGCGATGCTGAGCCGTCCGAGGCAACAGGCGAGTCG
CATGCCGCGCGCTTCTTAAAGTTGTGGGCCG