Description :
From Genome Similarity Track
Location :
scaffold_1312:2786- 3943
Transcript NameFunction/comments
g11282.t1hypothetical protein

Sequence
1157 bases(100 bases per row)
AATGGTGACGGACAATGCGAACGCCAACAAAAAGTCATGGAGACTACTCGAGAAAGAGTTTCCAGATAAATGTTTTCATGGCTGTGTCGCTCACGGATTA
CATCTTCTCGTCATAGATATTTTTGGAGCAAAAGAAAAAGTGCGTGTGGTGAATCAGGAGCCGCAATACCCAGTTCGCTGCGTGGCGCTACTAGGATGAC
AAAACCGCACAACCGATGTGATAAAGAGGCCAACAAATGTCTTTGTTTACGCGAATCCCACGTCAACTTTCCTGACGGGCCCCACGGCGCGGCAAAGACG
TTGTCAGCGTTGTTTTATAAAGCGACGCTTGGGGCTGAGTTCAAGTAGTACTAAGTAGTACTATCCAGTAGTTTGAGAAACTACTAGTTACTGCTGTAGG
ATAAGACTATTTAGTCCGGACACTACAACCCTATTTCTAACTCTCAACCAATAGCAATGGTTGGAATCGTCTTTATGGCCAATCAAACTTCGTTATGGGT
AGGGTAAGTTCGTTCTAGCTTATTTTCCGTAATTGTCCGGAATTGTGTTGTCTTATCAAATAAGAGACTTTAGTGAAGTCAATACAAATACCGGCTTATC
GGATTAATGCATTTTGTAACGGAACAATGCGTTCCGTACACGCTTCTTATTCTTTCCTGGCCCTTGAGCGGTGGGCTAGTACTCCAGGTCAACTAGGGAC
TCGTTACCAGACACCTGGTCTGTCTGGTATCCCTGTTCCTTTCACGCACCACCCTCTAATATAGAGGGAAATAAACCAATACAATCGGTTATAAACAACA
GTCTAGTATGCACTCTGAAAACGACTGTCTAGTTTCCAGAGTCTGTCCAAACGAGCAATATGAAATGGGCTACCCTTAGAGACAAGACAAACGACCCAAC
TATTAAATGGAATAGGCGGGTCCTCTTAGGTCTCTATGTTACGCTGATCACCACCTAAGGGGCTGAAGGTGGAGATCACACAGCGCTCGTCCTCGACGCA
GTGGCCTTACACTTCCTAAGAATCGACGAGTCTACCTCTGGATTATACCGCAAATTGAACCCTTTATTAAGGAATGTTATATGGCCATTATCTTCTGAGG
GGAGAGCCTAATAAGGCATCGTGATAAACACAGCACAAATCACGTGGTAATCCGGTA