Description :
From Genome Similarity Track
Location :
Scaffold_18:278525- 283795
Transcript NameFunction/comments
Hyaar_Emoy2803203PREDICTED: WD repeat-containing protein 89-like

Sequence
5270 bases(100 bases per row)
CAGACATGTGAGACTGGGACACCATTAGGTGGTCGGGAGATAAAACAAGCCCGTAGACAGCAATTCGTCGAACAAAATTATCGTCATGGATCCTGCAAGC
GTATCTTTAGATGCGTATGCAAGGTCCTGACTTGTGGCTTGTCCGCACCAATGAGCGCAGCTATAGTGTGTGCTGCCCAATATAGCCCCAAGCCGAGTAT
CGCAGAAGCTGTTATCACACTACACGATACCCGCGTAATGGTCCTACACTTAAAAGGCGTCAAATGCCTTCAAACCTTTCCTACTTTGCGCAGGAGCGGC
ATCATCGAAACTCCTCCCCTTTGGTCCCACGTATCTGCTAGACAGCGTTACTTTGCGTCCTGCACTGCATGTACTCCTTTGCAACAGTGTCTTGTATTAC
GCCCCGTGATGGTTTCGTATTGGAGACTATAGCTGTAGCCTGACAGACTTCTCGGGCGTTGCATCTTAGCGCGCACACTGAACCTAAGCGCTACGATACA
AACCGCTGAGCTAGCAGCAGGTGAGTGCATTCTACACATAAATGTTGACAAATATGCTGCTTGGTGTCATGAAGATCCGCAGCTGCTTCGCTTCATCGAG
TAGTGGAATGACTGCGACACTCGCAGGGACATGATGTACTGCAAAGCAACAGCTGCGAACACGGAACATGTAAAATGAGGTATCTTACTGTATTACGTAG
TTAATGCTGTAATATCTACCTCGAGCCGATGCAGTCAATAGCGATGTAGTGGTGCCAACGATGTCTAGCCCTCCTGACGTTCGATTTCTCTCAGGAACGC
CGCATATACATCATCCCCCTCGATTTTCTCCGTCTCCTTGACAGGACGTTGTTTTTTCGCATCGCCTATGGTCAATCCCTTCTTGCGCCGTTTCGCGAGC
TCGACGAGTTGAAGCTGCTTGGAATCATCCAGCGCGTTAAACGCCTCCTCTCTTTCTTTCTTCTGCGCAAAGTTTTTTGGCACGTATACCTTTTCACGTT
TGGCAGCTCTTTTTGCTGCAGCGTTACGGGCTATAGTCGCAGTGGTTTTGGCTTGGCCTGCATTACGGCGATCAAGGGCGTCGATTCTTTCTCTCAAGCT
TAATTTTCCCCCAACTTTTTTTGGTGCCTCTTTTGGAGCTGCTGGCGACTTCGAGGGCTTTGATGGCCTTCAGGGCTGCAACACGATTAGCCGTCTCAGT
TCCAGTGTCGTCAGTGGTTTGGGCGGCAACGCGACCGACGACCTTTCTCAAGCCGGCGAGGTGGCTGAAAACTCGCTTCTCGTCAAGTAAGACGACGTGC
TTGTCGTTTCGAAGCGACTGCCCTTCGGGAGAGTCGTTCGCAGCCAGAGTGTCGAACGTGTAGGCTTGCGAGTGAGGCTCGGGGGTTGACGTTTTCGATG
TTTGCTACTGTTGGTTGGACTTTGCACTTTTAATCAGCAGTGCTGCGTGCAGGAAGGGCTACCGAGACAAGGAGGAGGAATCGAAGCTGCATGGTAGTAT
CACAGTAGAGAAGGTGGCGGTTTGTGCACAAAGAGGGGAAATGGGAAGTGAGGATACACGAGACGAAAGTCCCAGCCTTCGATCTAGAGTCGGATGTCAA
GCGACAATGTTAGAAAGAAAGAGGTAACAGGGATCAACCTGTATCGACGCCCTTGCGTATCAAGAGCCCTTCCAACTAATCGTCTGCTGGAACGCAGTGT
ACGGCACGACAAGTATCCAAGATCGTGTGATTGTAGAGGTACCGCGTGGACTTTGTGGCCTCAAAAGTGCTGGCCATGTACATATGCATATGTATCTGTT
TTCTAGCTCGTTGGTTTCCAGCTCTCGTACACGACCTCTTCTCGTTATCATAATAAGCTTCTGTCTTACCCAAGCCAGTTAAACTTTCTTACCTATACTA
CATTTGAACATGTTTTCAAAATACGACGATAAGAACTATTCCTTGCACCCAGCGCTTTTATCGTCATCTTCGCTAGGGTCCTGTCTCTTAATCAAGCCGG
CAGCACCTCGCTCCTTCTTGTCTCGAGCGACAACAGTACAGTAGTCTGCTCTTCTTTTCTTGTCCTTCTTCTCACGTGCTCGTCGACCTCGTTGCGGCAT
CGTCATCTTATTTTTTGCACACGAACTCCTTCTGTCTCTCTCATGAACTACCCGTTTGCTACGATCCTACGTCATGCTGTAGCTTTCAACCTCTTGTCTT
TCGAAAGCACAGCTCTCGCCTTCCACGGCATCCGACAATGCCGCCTCTCAATGTATCGTCAACATTGCAGCATACTTCGTGATGAGACCCTGCACGCCGA
AAGCTCACAGAATGACAGCATCTACATGATTTTTGTGGCCATGGCAACACTTCCGCTCATCATTGCTTCATCGTGCGAGGACCGTCGAGCGTAGAATTGC
GTTTTTGGTAGAGCACGCTTTTTGTATCTCGAAACTGAGGCCTTGAGCGAGCTCTTTGTGACACGAGTCGACCTGCTTGTGGTACACTTCTTCCTTGCAA
GATGATCCATAGCGTTGATGAGAAGATGGCGACGATACAGCCGTATCAAATGACCGGACGACCAGCACACTAAAGGAATCTATTCACTTACTGCATCGCC
GCTCACCTTTACTTCATAGCAGCACCGTGAATTTAGGCACGAATAGCTGCTTTTTGTTCAAACATTTGTCGTTTCTTGAACCCGGGTCTGATCGTGGTGC
ATACGTCGCTGTAGAGATTGGTGGCCTTAAAAAAAGAACTGGATTGTCCGAGCTGCTTCAAGTGACGAAACCCTAGGTTTGAGCTCATAGACCTAGATCG
CGGGGAGTACATGCAACCTTTTTGTCCTATTTTGCTTGCAACCAGTATGGCTTGTACTTCCTTCCACGAGCACACATAGTGTGTGTATCAAGAAGCACTT
CCCACGACACGGGAAAGGCGCGCTCACCATTTAGTGCAAGCGGTACTTCGTGCCGCTTGCACTACCTACAGAGGCCCTTTTGTAGGCACAGCAGAAGTAT
ATTGGTTCAAATCGTTGAGCCAAACACCACACCCGAGGTAAAGCTGCTCGACCGTATGTCAGACAAAACGCAATACCTGCTTCCATCCACGCAGTGTCAT
CATCGAGAAATTATCGACTGCTGGTGGATACCCACAAGGCTTTGGCGATGTAGCACAGCTTGTTTAGTATGGTCTCGAGGGTCGGTGTAAGCACCAAAAC
CTATAACCGATTCTGAACTCGGGACGTTTACACTGAAATTCAAGTGTATTGACGCTCGACAATACCGCAACACCTTTTTCAACAAACTCGGTCGCTTGCC
ATCGCTATCCAATCGACGCACCTCGGTGTTATCTAGGCGAAGAAGAACCGACAAGCTTATTAATCTCTCTCCAGTTGACGCATGCACCAAGCACAATAAT
CCGAGCGACCTCGAGCTGGATACAAAGGAGACCGTCAATAGCTGCTACTTTCCACCGGGTTATTCTACCACCGTCAACACTGCAGAACGAATAGTAGTGT
ACAATACGAAACAGTATAAACATGCTCAACGCAAATCCTCTATTCGTGTCTTGTTCCCGCCAATGAGTACACACGCGCGTACAATCGCTCCATCTTCGTT
TACTTAATATACAGAGTACCATTGAATTGATCGTCAGAAATGGGATCGCCACCGATTTGTGTCCGGGTGTGCACTGTCATGGGGGGCTCGATCAAGTTCC
GAACAAAAAGCACTTCTGCCTAGTATGGACGCGAAGACTTGCGGGCTTTTCGTATACCTGCATGGTCCAGACCCGTCGCTTTTCGACTAGAAGTAGTTGA
CGACAGATTTAGAGGAGAACCAGACCACCCACCAGCTACACCGGATACCGTCCACTTGCAAAGCCTCGTGTCTTCCCCTCCCGTGTACAGCGTCGTGCTT
TCTCTGTCATAGTACATGCAGCGCACGCAAGCTTTGTGACCACCATTAAGCGCCGCCACGTGCTGTAGTTTTCCCTTCGAGGCGGCATTTACGCCAATGT
TGATCGCGTTCAAGTTGCCGTCGTGGCTGCCAGCCAGCACAAAGAGCTCGTCCGAGCACTCGTCGTACACGCAGTCAATGAGATAGTCCGTAGCCACGTT
ATTACCGTTGCAATCATCTCGAATTGTGTCATAGTGATGTAGTCTCTCTGCTGTCCAAATATTCCACAGATCTAGTGTCTCGGAGCCCGTAAGACAGTAG
ATCTTCTCCTTCTGTGGACCAAAGAAACCCAAGGTCGCAACAGCACTCTCGACGTTCACAATGCTCTCGAGCGCGTCGTCTTCGTCCGAGATGCGGCAGT
CAAACAAACACACGACCCCATCTTCTGAAGCCGTGGCGACAAACGCCGACTGGGTCGGATGGAACCGCACTTGCGTGATGGCGTCGACGTGGCTCTCGCT
GTACTCGCCGAGTTTCGAGCCCGTGCGCACGTCGTAAAACAGTGCGCAATCATCCGTTCCGACCGCCAGGAGCGTCTCTTCACACCCAATAGAGAGACTC
CAGACTCCGCGACCCACTGGCACCTCCATGGCCGCCAGCGCCATGCGCGTGTCCCACAGCTTTACGCACTTGTCGCTCGAGCACGTGGCCAGCTGATGCG
GTGAAATGCGTGACGTCCACACCTCGTGGATCGTGCTCTTGTGCGCGCAAAACTCGTGGGACAGAGCCAACGTCTCGAGGCTGCGCAGCTGCAGCGTGTG
GGTGGACAGTGCGAGTGCGAGACCGCTACGGTGGGCCAGAGGCTGGCAGTTTAACACGTAGTCATACTCAGAGGTGGCACTTGAAGCTTGGGCGGCAGCT
GCAGAGGAAGCTACAGCAGTGTGCGTGAGTGTGAAGCCGCCCTGAGCTATAGCCGAGCGCATGGATACGTCCGGTTGGATGGTAGCCACGGGATGACTGG
CTAGTCAGTTAATGGACTAATCAGGTGACGGACTAATCAATTGACTGACTAGTTTGAAATGACTGGCTGTGGTGCATTCGCTATTAGGGTATCTTGTCCC
GCGCGGGATGGGACGCGGGATATTTGCGAGCCCGAAGGGTGAAGCTATTATTGAGGGTGCGCAAGGTTGAATGCCGAGCTTTTAAATCGTACTTATCTCT
CTCTCTGTGTGTGTCTGTAAATGACGCGGTTAGGTGTATCCTACATGTACTAAGTACGATTATGCCTCTCTCATTTTCTCATAGGTACAGTATACAGGTA
GATTCAAAGTCACTCTTTGGTTAGGTCGATATTGTGATGCACGCACGTGATTGGCTTAAAATCGACTAAA