Description :
From Genome Similarity Track
Location :
Scaffold_244:2785- 5972
Sequence
3187 bases(100 bases per row)
CCCGTACTGGTGATAAGGCCCAAGGTGACCGACCGACGTAGAACGTAGGATTCGTGTGCATCTTACGTGGCAGTTCAATCGTGTATGCGTTGCCTATGCG
GCGCAGCACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTGGATAGTAGGACT
AGATCACCTTCGTTGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTTTTGTCGGTCCACTGCTTCTGCAATGGAATCTTGCACGAAATGA
ACAACCGTTTCGCGAGCCAGTATGAATTCATTTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGGAGCGCACTGTGGCAAGGTCAGTGACCTGGGTAG
TAAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTTGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGATGAGTG
AGAGCTGACTTGGCGTTCGCTCGAATGAGTCCCTCCCCCCCCTCAAACTAAAGTTACACTCTAAGAAGGTGGGTAGGCGTGGGTGGCGTAAGCCATTCAC
GAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCTAATTCGTAAACGAATGGACATAA
CCCCGAAGGATTTGTTCAAGAACGCGGTTTGCACGTTATGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGCGTTCCGAGTGTTT
TGAACACGGATCGCCAGAATTCCGCAGTGAACCGTGGGTCTCGATTAGAGACGAGTTCACGAGGCAACCCATGACGACGAAAGATCGTGTCAATAAAGAC
ACGAGCACATGCCGATGCATTGATAGATTCATTTACAGCGACCAGGTGAACCATTTTACTGAATCTATCAACGAACACAAGAACACCTGTATCTTGTGTG
GGTCTGCGGGGAATCCAAAGACAAATTCCATTGTGATTCCCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGGGAAGGAATTGAATTC
ACTCGTTGACATACTTCGCATGCGCGGACGTACTTTCGCACGAACTGATACTGGTGGGGCCAGTAAAAGTCGCGACTAACTGTGAGATATGTCTTCTCTC
GACCACGATGTCCATCAGTAGGTGCATCGTGGTACTCATACATGATGCGCAGTCACAGGTCACCATGATCCGGTACGACGACACGAGGCGTGTCGCCGGC
AACGGCTGTATACTTCAGTAAGCCATTGTGGACTGTATATCTATCCGTGGAGGATCGATATACTGGGGGCAACCTTTTAAGAGATAGACGGGATGGTTGC
GAGAGATGATCCATCAAGCGCACCATCACCGGATCGTACGCCTTGAGTATGTCTTCGAATAAGGTTGACGACGGGACACTCGACGTCAACCCCACGACAG
TGGTCGGACCAGTGTCGGGTTGCGCAGCGGGTTCGAAATCGGGCCGGCGCGACAGAGCATCAGCGACGACATTCAGTCGTCCTGGATTATATTCCACGGA
GAAGTTGTACTCCGCGAAGAACGACAGCCACCTCGCCATTCGTTGCGAGAGGTGTGGACTGTCAACGGCCGTGCGTAAGGATGCATGGTCCGTATAAACG
ATATAGGGTCTATCACCTAGCAGATAGACCCTGAAATTTGCCAAAGCATACTTCATGGCAAGGAGTTCCTTGTCATGGACTGGGTAGTTACGTTCAGTCG
GTTCCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCGTTTGCGTCATACTGCATCAGTGCACATCCGATGGCAAAATCACTTGCATCACCGAC
CACATGAAATGGTCTGTCTTGGTCTGCAACCGCCAAAACTGGCGATCGTATCAATCTTTGCTTGATACCTTCGAAGGAGCGCTGGCAATCAGCACTCCAT
GCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATCGTGCGATTATTTGTGCAAATACGCCGCTGGACCAGGAACTT
TCGAAGTCCTTTTATGTCGGTAGGCACCGGCCGGTCAGTGATCGCCTTGATCTTCTCTGGATCGGGCTGGACGCCGTGCTTAACCACGATGCATCCAAGA
AGTGGTATTTCGCTAGCAGCAAATATGCACTTCTTGAGGTTGGCATACAACTTATGCTCACGCGTCAGTGTAAGAACCTTTCGGACGTGGAGTCGGTGTA
CTTCTACATCCGTCTGTCTATCCATAGCCCGGCTATGGACGAACACGTCATCGAAATAACTAGGTGAGAACTCTCGCACAGATTTCAACAGATCCGTAAC
GCATCTGTTGAAAGTAGCAGGGGCATTACTCAGCCCTTGTGGTATTACTAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACCGCAGTATACGGAATT
TCCCTTTCACGCATAATGATCTGATAGAACACGTCCGTCAGATCCATCGATGAAAAGATGATACTCCTTGACATACCATCTATAATGACATCCTTCCTTG
GTATCGGCGTTTGAGCCGGTACAGTTGCAGCATTCAACTTGTTGAAGGCATGTACTACCCGCCATCCTCCTGTGGCTTTCGGATACAGAAGGTCGGGGAG
CTATGTGGGGAAGTAGATTCCCTCACATGGCCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACTTTTTCACGAGGCAGTGGCCATTTCT
TCATGACACATACTTTGAACCTGGTTTCAGGTCGATCTCATGCCGAGTACCCTTATCCTTTGGTATCTCGCATGGCATTGTTTCTGGGAACACATCTCTA
AATTCCATCAAATCATCGTAGAGAGGATTTGTCTTGGGCGATTCCCACGATTGGGATGTATATCGCTCAATCCAAGTCTTCTCATCAAGGACACTCTCGT
CCATTAATGAGCTGCTGAGAACCCTTTCGTTTTCAGCGAATACCATTGCCGACCGAATATCGGTTACGTACTCGTCTTCCGCGACGAGTACAAAATTGTG
CTTGACTTTGCCACTACGCATATCACGCAAGAACCTCTTCTGTTCGAGCGTGGGAAATTGAATGATCTACGAAGATGTCTTCGGAGG