Description :
From Genome Similarity Track
Location :
scaffold_351:27845- 30237
Sequence
2392 bases(100 bases per row)
ACACCGTCACATGTACCACAAGGTGTGAGGGACTCTGCCACGCATTTCCAGAACGAGATGCAAAAGGACTTCGCCGATATGTTGTACGTCCACCTACTGG
TGTGGATCGATGACCTTCTTGTCTGCGCAAAAGATGCACCGACCCTTTATTGCAACTCTTCGCCAATTTTTTGGCCTCGTTCGTGTGCACCGTTTGAAGC
TAAGTGTCAGTAAGAGCTGCCTTCTTAAGGAAGGCGATTCGTTGGCGTGGTCGCGTTTTCAGCGGTAGTGGTATACGTCACGACCCTGCACGCATCAGCG
CCCAACCGGAATTATCTCTGCCGTATACTGCTGCCGATTTGAAGCAATTTTGGTGCGCTGCGGGCTGGATGCGCGACACACCCGGTGACTTTGGGCATAC
TAAGTACCCCTTTATGACAAATTGTAGACGATTTTGAGTGTGAGTGGACGCACCAAAAAGCTTTCTGCAGGCACTGAGCAAACGCGGACACCTGAAGAAG
AAGACTTGTTCGCAGCAGCAAAGAAGCTTCTCGTATCCCCTCAAAATGCTCCACTGCCCGAAAAACTCAGCCATCGTCTCAGTGTTCAGCGACACCAATG
AACTCGGTGAGAACCTGTTGCCACTCAAGTGGGTAATTGGAGCTCTGAATTGTCTGTTACTGAGCCACAACATCAGCTTTTGGATTGTAAGAGCGGAAGT
TTTGACGACACGGAACGGCATTAGAGCATCATAGAGAAGGAGCCCCACTCCATCATTAGGGCTGCACGTAACCTCGGCCACCTTCTCATTTGACACTTTG
GCTTTCGGCTTTTCTGTGATCATAAGAACCTGATCTTCGTGTTCGCATTAAACCATGAAGTAAAACGCCACATTCGTGGCCAACTCCAGCGGTGGGTGTT
GTCACTCACGGGCTTCTCGATCAGGTCGAACATATTGACGGCTCCGCCAACGTGTGGGCAGGCCATTTTTCGCGCTGAAAGTCAGCGCATTCGAGCGAGG
TAGGGGCGCTCGTGAAGTGCAAGTTTGTTACGCGACCGACAAATGGACGAACAGCGTCCACGGCAAGGTGTTTCTTTTTCCAACATTGGAAGAGGTATAG
GTACAACAGCACAGACACAAACAGGTTGCACCGGAGGTTGTTTCGAGTGACACCGGTGTCATGACTATCGATGAGCATATCTGGATTCCACATCTGGCAA
AAGCATTGCGACTGCGCATTTTCATCGTGGCTAATAGCGGCGGCCAAGGTCACCGTAGACTTGATGCGAAGTTGATGGCGATCAAGGCATTGTTCACATT
CAGCAGTTTGGAGAAACACTGTGGCAATTTTACAAGTGATGTTTTTTTGTGTAAGCATTTGAAGGGTGAAAACGTCATTCCACGACCGTGGGGACCTCCC
TACAACGCCACCAAACGCAATGAGATGCTGCACTACGGCTTTCTTTCGCTTGGAGTCAGTGTTGGAGGGAGCAAGTCTCTTCTTGTGCTGAAGGATGGCA
ATACATTTCTGAGAGCTAGTGGCCTGTGATTCGTCGACGAATGCAGTAGCGACCAGTGCTCTTGTGGATCGATCAAAACGCTTCAGACCGCCTTATAATT
TGTTTCCCGACCAGAAAATTTATTTCAAAAACTCTGCCGGCAGCTTTTGGTTGAACAAGATATCGTCCTAGCCTATGCAACGTGGATTAAACGACCCAAC
CGAGAAATCCAGCAAGGATTACGGGTATTATTGATGGAAAATAAGCTGAATACGCATGAGTGGGAATATTTAGTGCCTATCGTCCAAGCTATTTTGAACC
ATACTGCCTCCTCGCTGGAGCAACCGTTCACCAGGAGAACTTTTCACTGCACTGTCATGACCGACACCTTTCGAGACTATCGTGGTCGAGCGCAATGCAG
GGCGGTGGTGATATCTGAGCCTGTGAATGCCCCTAGTACTATGGTGGAAAACATGCAACGTAGCCCACGCGAAATGCACACCGACATCGGGATATCCGGG
AGCGGTGTCGTACACAGAATATGAGCCGCTCCAACGGAGTCCCATGCAACTTCTCCACGGGAGATTTTGTACACTGGTCCCGGATCTACTCACGTCTCAC
CGTCAACAAGCTGTTGGATCGTTGGATCGGACCGTTCGAAGTGGTGCAAGAGCACCCACACTCGAACATTATCCGCCACCTCTTAAGCGACAAGCGCTAC
ATGGTGCACAGATCACGCCTCGAATTCTACCGTGACGACAGCCTCGGCAGTAGTGAAGATCTGTTAGCCCATGTGGGCAACCAGGACATGGTCCTTGGTG
TTGAAATGTTCAAGGGACATAGCAACATGCAGCAAGATTGGCAGCTACGTGTCTCTTGGTTTGTCTTACAGAACGGGGAGGCCTGGGAGCCT