Description :
From Genome Similarity Track
Location :
Scaffold_50:278253- 284983
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15600glycosyltransferase

Sequence
6730 bases(100 bases per row)
AGGGGCGCGCATGCATGAGCGGCGGCGCGGCGTTGGCGGGGGTTTCGTACATTTGGTAGCCGCCGCCATGCGCCGCGTTGCCCCGCTGACCAGCGTTCGA
CTTGGACCGCACACGACTGAGATTCCGCTGGCGAGCAGTTCCAGGCGTCCGCGTGTTGCGACTTGCGCGTTCAGCACGCATGCGAGCGATGCGATCACGG
TCGCGCTGAGCTTCTGTCTTGGTGCAGATGACGCCGTTCTTCTTGGTCCCTGCGCCCAGCAGCAGCACCAGAGCCACGACACTGAAACCTGCAATACCGT
AGAGGTAGAAGTACTCGTTCTCCATCATCGAGTCGTGCGTGTGCATGTAGACGTAGCCCAGATCCGCCAGGAAGAAGATGGCGAACAGCATTGTAGTGGA
CGAGGCGCGGCCGCGAGTGTTGAACATGCCCACACAAGCCGACCACAGAGCAGAACTCGTACCCAGACCCATGAAGAAGTACATAAGCATGACGACAAGA
CTGACGTACAGTCCAGAGCCTTCCGTGTCTCCCAGCAGCTCCGAGTTCTCGTTGAAGCCCAGAATACCAGCGCAGATGGCGATAGGGATCAATGTGCCGA
ACAGAATCGACTTGTGGTCCAGCTTGTCGATGAAGAAGATGGCGATCGCCGCACCGGAAATCTGCAGAGCCATGGCGTTCACGAACAGTTGGTCCTGGTC
AGTGTACTCACTAGCTCCCTTGTAGCTGATGAAGGCGTTGAGGAACCCAGTAGTCAGTGACGACACAAGCATCAGGAACAAACCAATGAGGAACTTGTAG
GCTCCAGCACCTCCTTCGTCCGCTGTCTCCTCTTCCCGCATGATCTTGAGCTCTTCTTGTACGTCAGGTTTACGCCGCAGGATCACCAGACAGGCTTCAC
AAGCATCCCAGCCCTTGCGATCCAGCACCCAGTACGGACTCTCCGGGAACACGTTCACGACCGGAGTGACCAACGCAATGACGATGCAGGCAGCGAACGT
CTGCCAGATCCATCCCAACTGGTTCACAGTTGCGAAGATACCACCAAGCAAACTACCAATAATAAAGCCCATGCCCAGCAGCAAGATAGCCTTGCCACGC
ATCTCCTTGGTCGAGATTTCGAAGATGTAGATGGCCAGCGACGGCAGGAGAATACCACACGACGCACCAAGTAGACCAATACCAGGCATCAGCAGCGTCG
AGCGGAGGTCGTCGTTGGCACTGACAGCCACCATACCAAGGGTACTAAAGAGACCACCAGCAACGATCGACAGACGACGACCAAGGAAGAAGTTGAGGAA
TCCAGCGATGATCGTGCCCACCACACAAGCGCCGTAGAGCATGTACGTAGTGGTACCGTCGCCTACATTTCCACTCAAGACGCCATCGTACGTGACCACG
TAACTCGCGAAACTGGCGGATTGTTCCAATGTTGACAGCAGGTTGAACAGCCAGCCGACACCAATGCCACCGAGGACACCCATGAAGGCTGCAAGGGAGA
AGGCGTACTGCGAGGAAGCCGACATGACCTTGGAGAAACCTTCGTTGTACATCATACGCGTCTGGATGACATTCAAGAACGGGATGCACGACATGACCAC
GAGCGGGATGATCATACCCGTGCAGAAGATAAAGTCGAACAGGAACTGCAGCTGCTGGAACACCGGAATGCCAGCGATCGACGAGTGCGGGAAACTCCAC
ATGCGGAAGCACTCGTTGATGCCGTACAGCGCAGCCACGTAGGCGAAGAAGAGCGACATGGCGTACTTGAATTTCCAGTCCAACACGATCCACGTGGCCA
GGAAGTAGGCTGTAACGATGGCAGCAATGGTTCCCAAGTAGATCACAGCGCGCGTCACGGGGCTCATGGAGCGCATGCCCATGCCAAAGCCGTGGAACAC
TCCAAGCAGAACAATCGTCGCGACAGCAGCACCGAACGAGTACGCCACGTACATGACGTCTGACGTTTCGAGCGTAGCCACGTAGAACATGAGCAGGAAG
TGGCGGCACTCGCGGAGAATGACCGTGACACGCGAGATCATGTTGGAGTTGTGAAGCTGCTCCAGGTCGCCCTTCCACCAGCCTACCCAGCCTCCCTTGT
TAGCCGGATCGTCGTCTTTGTAGTCTTCGGGGGCAAACATCCACATGCACCACTGCTGGACATCCACCTTCGTTTTCCTGAAATCAAGACCGTCACTGTT
GAACAAGAACGGACCAACCACCCACAGGATGGAGATGAACCACACAGAGAACGTCTGCACACCATAAGCCTGGGCGGTCTCACAGTAGTCGGACGCGAAC
GTGTTGTCGTTGGCGGATGCATCCGTCTGACAGATGTAGAAGTTACCGAACGCCATGTACACGAGACACAAGCCGATCAATTCCCAAGCCTTTCGATAGT
GTGAACTTGCATAAGCCTTGTACAGAAGCACCAACGTCTCACGAGAAATCTTGAAACCACGACCCGTAGCCTGGTACTTGGCACCACCGTGCACGATGTT
GTTATCGAAGTAGTGCATCGTCGTACCGACCTGGAACACGAAGAACGCAGGGCCCAGAGTGATGATCATATCGATGAATCGCGTCATACCGCGCACAAAG
CCACCTTCACCAAAGTACACACACATGAGCGGAAGCATGAGGAAAGTACCGGCTTGGATGTAGAATTGAGTGTTCAGCACAGCCTTCAAGTCCGTGAACA
CGCGCTCGTCGAAGTTGTTGGCAATATTCTCGGTAATTACAGCGGTCGAGTTCATGTCGTACACAATCTGCTGCTGCACACCAGCCAGAGCCAAGTACAC
CTTGCAGTACATGTACACAAAAGTAGTCACGATAGTCATCCACGTAGCGAAGTAGAAACCCGTGTGCGAGTAGTACATCGAGTTCAGACGGAAGAAGTCC
ATGAACTGGCCCATACGGTGAGCCTCACGAGCAAGCGAAGTCTCTCCGGCACCGTTAGCCAGCTTACCTTCGAACATAGAAATCTGTGAAAGAGCCACAT
CACGACCCTTACCACACTGCATGAACTCCACGTGCGTCACCACACCTCCACGGAGCGTCGAGTTGAAACCAGCGAACACATCCTCAGACAAGTTAATGCC
CTTGGAAGCCTTGGACACGCCACCACGGGGCATGGCAATGATCTTGTCGAAAATATCGGGGTGACCGTAGTGCATACGCACGTACAGCGGGTCGGCCAGC
ACACGCTGAGACAGCGTCACGAACACCAGCTCCTGCCACGACTTGAACTTGGACAGCGATGAGGCGTTACCTGTGAAAATATGCTCACGCATACCAATAA
TGGACACAGGTTTCTTCGACGGGTGCAGGTCAGCGGTCACCAGGAGTTGCGGCATCTTCAGACACTCCTCAAAGTAGTGCTGCTGGTTCATATCAATCGT
CTGCAAGTACTCGCCACGTGTGAACGGAAGCGCGTTGTTCTGGTTCTCGGGCTTACCTTCACCAAGAATCGGGTCGCCAGGCAGTTCGTAACGGTACACT
TCAGCAATTTCGTTGCCTTCACTCTTGATCAACACAGTGTCGAACTGCTTGCCACCGTCAGTGACGATGGTGTCGACGTAGGCAACACGCAAGTTCGGGT
ACGTCTTCAGCAGGTAGTCGATATCATCGGCCTGAGCCTTGTTTTCTGCGCGATGCTTACCGTACACCTGACAAGCACAAATGTACGAGAATTTCAGACG
CACCATATCCTCAAGCTGGGCCTGTTTCTGCTCAGCTGACTTGCCGGGGCTCGAACCAATCTCCAACCAGTGAAGAATCTTGATAGCATCCTCGTACAGC
ATCATACCCTGAACAGTACGCGCGAGCGTCTGACCACGGTACGATGCCCACAGGCGAATCTCCAGTGGGTAGTTAGCTTGCGCTTCCTCTGCTGTGCTCA
CATCAATACGCTCCAAAAAGTTCTCCCACTCCTCCGGGTGGATCGTGATCAGATATTTCAGAATGGTAATGTTTTTACCCTTCTCCTCCACCTTCTGGAA
AACCGGGTGGTTGGCAAGCGGATCGTTCAGCTCAGACAGAGAGATCAACACGCTTTCACTGTAGAACGGCGTCACCACAGAGAACGAGTGCATTTCCTTG
ACCGACGTCAGCTGCGGGATGTCCATTAGAAGCGACTTCATGAAGAAACCAAGACGACGCTGGGCCTCAGGCACGCGTGGCATGGCATCGGCCTTCTCCA
GCGACATCAACAAGTACGCGCGGGTAGCAGCACCCATAGCGGTGTCGTTGTGGAACAGGTTGACGAGGCCACGAGCAGCAAACACGTAGCCGTTCGCACT
CGAGCAGAACTTGGAGTTGCTGAACTTGGCGGCAAGCTCGGGGCGGTTCGCGAAGATGCGAATAGCGTTGAGCAAGTTCTCCATCTTGGTCACGAAGTTA
CGCACAACTCCCATGGTGTGGACACGAGATGAAGTCATGTGCGAGGACTGCGCATCCGGGTCGGGCAGATCCATCACTGCCTCCAAGAACTCCATCGAGA
CCGTGCGCAGCTGCACGAGACTCTTGGCGTCAAACGTGCTCATGAAGCTACCGTTCGCAGCAATCGCCTCCATTTGACGCAAAGCATCAAGGATGTCCGC
ATCGTCACTGCCCAGCAGAGCTTCCATGACGTACATACTGGCCGTGAAGAAGCTGCGCACAGCCGACAGACAATCCTTCTGTACCATGTACACCTGAAGC
TGCGAGTCACCCTTGCCTTCCTTGGCAATCTTAACCGTGTAGTCCAGAGCTTCTACGAGCTTACCAGCCGAAAGGAACACAGGCTCGAACACGTCACCAG
AGCTCTGAATGTCGTACTGCAGGATAGCAGCTTCCTTATCGTCCACTAAGTCACCTTCGCGGAACGAATTGACAATCTCATTCCAGACGACCACGAAACG
GAGCATCATTTGTGACTGGTATGCAGCAGCAGATCCATCGGCCGCAGCATCGTTCGAGCGGGCCAGGTTGGTCACCACCTTCTGGTCGAAGAGCTGAGGA
GCCACGCGGAACGCCTTCGTGATTTCCTTGATGCCGTGGATTTCACCAGTCTTCATGATGAGACCTTGGAGACCACCAAGCGAAGCCTGGAACACCGTGA
AGTAGATCTGAGTATCGTAGTTGAAGATGAAAATCACGGGTAACCACAGCGCGGCGATGACACCGAAGTTGTGGAACGACACAACGTTGCTACCGTACTC
GAGCTCCATCTCGTAAATGGCCAGCGACGGGAGAACCAACGGACGAACCAGAATGAAGTACGAGATGAATGCCTTCAGCGACCACAGCACCAGCCAGAAG
GTGATGTACTTGATCTGGTAGCTGAGCGGAGGCGCCATGTTGCGACCCACGTAGCATGTTTCACCTTCACGGATAAACTTGGCCGCAAACGACTTGGTGA
TCATCGACGGTGCAAAGGCCTGGACGACGATGATAAGCGCACCGGGCAGGATGTAGGCAACAGAAGCCGGTGCAGCCTTGTCCAGCAGCTCCGTGTTCTT
GCTCGTAATCAACGGGGTGTAGATCATCAATCCGAAAATGCCAGCAAACGCGCCGTTCCAGAGCATACGGAGCACGAGGGCACCACCGTAGTTGAACGAA
CGCGATGACGTCTCCGATGACTCGCTGGCAGTCAACAAGTGCCATCCGTGACACGCTTCAAGGACGGTCTTGCAGAATCCCATCGACGAGAGTGCGAAAA
CAATACCCACATACGTCAGCTTGACGTCCTGTTGCTGGTACGGCTCAACGACTTCTCCCAAGGACTCGAATTGGGCGAACCATTGCTGTCCTCCACTCGG
CGAGATGGCCGAGATAAAGCCGATAGCCATGAGCACCATCATAAACATCATGTTAAACTGGAAAATACGGTAGTAATTCAGCACGAGCGTGAAGATACTT
CGGTGCTCGTAGTACGTCTTGGTGTGTTTCTTGGTCAATTCCTCACCGATCTGCGTGATTTCCACATTGAGACAGTACTTTTTCCAGAAATACTCGTTGA
TGTCGTCGTAGTTGCGCACTTGAGTGTGCTCCAGGTTCTTGCCCAAGCTGTTCTTCCTCTGCATGTTGGACGCCTCCTTCCAGATGGGGCGCACCACCTG
TCTTAAGTACCATCCTTCGGGCACTTTCTGCTGGCCGAGAAAGTCCTGGTTGAGCATGTTGAGAGCCTGGTGATACAAGTAGCAAAGACACTCAGGCATG
TGCCGTAAGTTACCAGCTTCTCCCCATAGCAACAGAAAGAGCATAATGTCCATGTGCAGAGGGTTCTTGAGGTCTCCCTGTGGCTGGCCATTGTACGAGA
TACTAGGCACGCCGATGAACTGGCACCAGTCCGTGTAGTTGCTCATCAGCTTCTTGTGCAGCGTGACGACGTGGTGTCCTGGAGGGTCCTGGGGCTTGGA
GCGCGCCTTGGAGTTGGCCAACAGCAGCAGAACGTGCTCGCGCTGGTTGTCCACACTGCCCGACTGGAAGCCGAACTTGTTGTACAGCACCTCGCAGCAG
AAGTCAATCGACACCTCGTCCGCAAAGTCGCCTTGTAAGCCACCGCCGCGCATCTGGTTGCCGCCCTGTGTGTTAGGAGGGAGAACGTCCATCATGCTCA
AGCGGTCCCCGAAGGTTCCGCGGCCGTCGCCGTAGTTGCTGCGGTTGTTGGACGTGTTGCGCTTACGATCCGCATCGAGCTGGAAGTAGTTGGAGCCGGC
GCGGCGCCGATCCATCTTGCCGCCGGGCGT